ID: 1035577469

View in Genome Browser
Species Human (GRCh38)
Location 8:716943-716965
Sequence GATAGAAATAACCCTCCTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035577467_1035577469 6 Left 1035577467 8:716914-716936 CCTAATTCTGGCCTCTGGGACAA 0: 1
1: 0
2: 1
3: 18
4: 226
Right 1035577469 8:716943-716965 GATAGAAATAACCCTCCTACAGG No data
1035577468_1035577469 -5 Left 1035577468 8:716925-716947 CCTCTGGGACAAACACGTGATAG 0: 1
1: 0
2: 1
3: 1
4: 64
Right 1035577469 8:716943-716965 GATAGAAATAACCCTCCTACAGG No data
1035577465_1035577469 10 Left 1035577465 8:716910-716932 CCTTCCTAATTCTGGCCTCTGGG 0: 1
1: 0
2: 1
3: 23
4: 251
Right 1035577469 8:716943-716965 GATAGAAATAACCCTCCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035577469 Original CRISPR GATAGAAATAACCCTCCTAC AGG Intronic
No off target data available for this crispr