ID: 1035579245

View in Genome Browser
Species Human (GRCh38)
Location 8:729659-729681
Sequence TTAAGGACATTGTGGTTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 240}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035579245_1035579250 20 Left 1035579245 8:729659-729681 CCTTCCAACCACAATGTCCTTAA 0: 1
1: 0
2: 2
3: 12
4: 240
Right 1035579250 8:729702-729724 CATTCTGTCACATATCCAATAGG No data
1035579245_1035579251 29 Left 1035579245 8:729659-729681 CCTTCCAACCACAATGTCCTTAA 0: 1
1: 0
2: 2
3: 12
4: 240
Right 1035579251 8:729711-729733 ACATATCCAATAGGAAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035579245 Original CRISPR TTAAGGACATTGTGGTTGGA AGG (reversed) Intronic
903116748 1:21184567-21184589 CTAAGGCCACTGTGGCTGGAAGG - Intergenic
904644872 1:31958143-31958165 TTAAGAACATGGTGATTGGTGGG - Intergenic
905764438 1:40588507-40588529 CTAAGGACTTTCAGGTTGGAAGG - Intergenic
907950893 1:59182631-59182653 TTAAGGCCACTGTGTTTGGAGGG + Intergenic
907980517 1:59476020-59476042 AGAAGGTCATTGTGGTTGGATGG - Intronic
908241513 1:62192884-62192906 TTAAGGACAACTTGGTGGGAGGG + Intergenic
908640612 1:66218819-66218841 TTAAATACATTTTGGTTGGATGG + Intronic
910390858 1:86742329-86742351 TTAAGGTCACTGAGGTTGGAAGG - Exonic
910530328 1:88228691-88228713 ATAAAGACACTGTGGTTAGATGG + Intergenic
910620567 1:89248884-89248906 TCAAGGACATGGTTCTTGGATGG + Intergenic
911256953 1:95644251-95644273 TTAAGGATGTTGAGGTAGGACGG - Intergenic
914943737 1:152045525-152045547 TTAAGGAGATTTTGGATGAAAGG + Intronic
916208490 1:162338594-162338616 TTAACGACTTTGTAGTTGGTTGG - Intronic
916553894 1:165876116-165876138 TTTAGGACATTGTAGTAGGTGGG + Intronic
916918435 1:169437071-169437093 TTAAGGACAATTTGGTGGGTGGG + Intronic
917594492 1:176515363-176515385 AAAAGGGCATTCTGGTTGGATGG + Intronic
919468265 1:197948348-197948370 ATATAGTCATTGTGGTTGGAAGG + Intergenic
920855508 1:209658082-209658104 ATAAGCACCTTGTGGTTTGATGG + Intergenic
921740090 1:218674431-218674453 TTAAGGACACTCTGGTTGTCAGG - Intergenic
923483718 1:234408748-234408770 TTAAGGATAATTTGGTGGGAGGG - Intronic
924115101 1:240737470-240737492 TTTAGCCCATTTTGGTTGGAAGG + Intergenic
1064381788 10:14849351-14849373 TTAAGAACTTGGGGGTTGGAAGG + Intronic
1064408364 10:15084297-15084319 TTAAGTACATCCTTGTTGGATGG + Intronic
1065207897 10:23374543-23374565 TTATGGACAATTTGGTGGGAAGG + Intergenic
1067799875 10:49351567-49351589 GTTAGGACATGGTGCTTGGAGGG + Intergenic
1069135745 10:64762974-64762996 TTAAGCCCACTGTGGTTGTATGG - Intergenic
1072770371 10:98132880-98132902 TTATGGACATTTTGGTGGGCAGG + Intergenic
1074011830 10:109489997-109490019 TTATGGACAATTTGGTGGGAAGG - Intergenic
1074709703 10:116167093-116167115 TTAAGAAGATTGTGGTGGGCCGG - Intronic
1075311143 10:121414545-121414567 TTCAGCTCCTTGTGGTTGGAGGG - Intergenic
1076496043 10:130898490-130898512 TGCAGGACATTGAGGTTTGATGG + Intergenic
1076653676 10:132007178-132007200 TTAAGGACAATGTGGTGGGTAGG + Intergenic
1077273582 11:1693206-1693228 TCAAAGTCATTGTGATTGGAAGG + Intergenic
1079787846 11:24698029-24698051 TTAAGGACAATTTGGCAGGAAGG - Intronic
1080246880 11:30189374-30189396 TTAAGAAGATTTAGGTTGGAGGG - Intergenic
1080760856 11:35247637-35247659 TTTATGACATTGTGCCTGGAAGG + Intergenic
1082930371 11:58596975-58596997 TTAGAGACATTGTGTTTGGGGGG + Intronic
1085658495 11:78339881-78339903 TTTAGAATTTTGTGGTTGGAAGG - Intronic
1087983371 11:104645797-104645819 TTAAGGGCAGGGTGGTTAGAGGG - Intergenic
1088312125 11:108471096-108471118 TTAAGGACAATTTGGTGGGTAGG + Intergenic
1089574015 11:119428770-119428792 TTAAGGACATTGTCCTTGCCAGG + Intergenic
1090107929 11:123871396-123871418 TGATGGACTTTGTAGTTGGAAGG + Intergenic
1090837152 11:130462029-130462051 GGAAGGACATGGGGGTTGGAGGG - Intronic
1091290428 11:134436401-134436423 TTTCGGGCATTGTGGGTGGAGGG + Intergenic
1092121166 12:6044873-6044895 TTAAAGCCATTGTGGTCAGATGG - Intronic
1092682890 12:11007311-11007333 TTAAACCCATTGGGGTTGGAAGG + Intronic
1092746702 12:11679091-11679113 TTAATGTCATTGAGGTTGAAAGG + Intronic
1093125139 12:15319847-15319869 TTAGTAACATTGTGGTTAGATGG - Intronic
1095373174 12:41494672-41494694 TTAAGGGCATGGTGTTGGGAAGG + Intronic
1095492195 12:42746442-42746464 TTATGGACAATGTGGTGGGACGG - Intergenic
1095887674 12:47205963-47205985 TTAAGGACAATTTGGTGGGTTGG + Intronic
1096836965 12:54357297-54357319 CTAAGGCCATAGCGGTTGGAGGG + Intergenic
1096841602 12:54383287-54383309 TTCAGGCCTTTGTGATTGGATGG - Intronic
1099738208 12:86597783-86597805 TTAAAGGGATTGTGGATGGAAGG - Intronic
1100588770 12:96004655-96004677 GTAAGGAGGTCGTGGTTGGAGGG - Intronic
1102376169 12:112422972-112422994 TTAAAAACATTGGCGTTGGATGG - Intronic
1102451696 12:113046764-113046786 ATAAGGACACTGTGGTTTGATGG - Intergenic
1104197379 12:126554034-126554056 TTAAGGATATTTTGGTGGGTAGG + Intergenic
1104546071 12:129714064-129714086 TGAAGAGCAGTGTGGTTGGAGGG - Intronic
1105276547 13:18933653-18933675 TTAAAGAGACTGTGGGTGGAAGG + Intergenic
1107194538 13:37633335-37633357 TTAAGGACACTGAGCATGGAAGG + Intergenic
1108738570 13:53310969-53310991 TCAAGGACACTGTGCTTGGGGGG + Intergenic
1110776338 13:79412295-79412317 TTAAGGACAGAGTGGTGGGAGGG + Intergenic
1112600132 13:100847172-100847194 TTCATTACACTGTGGTTGGATGG + Intergenic
1113318617 13:109209913-109209935 TTAAGGAGATTGTGTTTAAAGGG - Intergenic
1115722364 14:36177112-36177134 TTAAGGACTTTGGGGTTTTATGG - Intergenic
1116690846 14:48103858-48103880 TCAAGGACAGTTTGGTTGGCAGG + Intergenic
1117072982 14:52072664-52072686 TTCAGGAAATTGTTGTTGAATGG - Intergenic
1117140092 14:52781139-52781161 TTAAAGACAATGGGGTGGGAAGG - Intronic
1117258707 14:54006911-54006933 GTATGGAGATTGGGGTTGGAGGG - Intergenic
1118009776 14:61598662-61598684 TCAAGGACATGGTGGGTGGGGGG - Intronic
1118436225 14:65773064-65773086 TTAGGGAAGTTGTGGTTGTAAGG - Intergenic
1118642857 14:67808423-67808445 TTAAGTACATTGAAGTTGTATGG - Intronic
1121435730 14:93917938-93917960 TGAGGGACAGTGTGGCTGGAGGG + Intergenic
1121445204 14:93974300-93974322 TTAAGAGCTTTGTGGTTGGGAGG - Intronic
1122308575 14:100780653-100780675 GTAAAGACTTTGAGGTTGGATGG - Intergenic
1122840437 14:104459751-104459773 TTAAAGACAGTGTGGTTGGAAGG + Intergenic
1126888136 15:53174496-53174518 TTAAAGACATTGGTTTTGGATGG - Intergenic
1128331287 15:66757361-66757383 TTAAGGAAAGGGTGGCTGGAGGG - Intronic
1128703940 15:69824796-69824818 TTAAGGAAACTGTGTCTGGAAGG + Intergenic
1128949165 15:71857480-71857502 TAAAGGGCATAGTGGCTGGAAGG - Intronic
1130854274 15:87827104-87827126 ATTAGGACAGTGGGGTTGGATGG + Intergenic
1131121762 15:89827497-89827519 TAAAGGCCAGTGTGGCTGGAAGG + Intergenic
1132276002 15:100564484-100564506 TTAAGGATAATTTGGTGGGAAGG - Intronic
1133626701 16:7576454-7576476 TTCAGGTCATTGTGGGTGTATGG - Intronic
1134077824 16:11304430-11304452 TTAAGGATATTGTGATTTGGTGG - Intronic
1135192877 16:20369053-20369075 TTAGGGACCTTTTGGTTGGATGG - Intronic
1137357060 16:47777181-47777203 TTGAGGTCTTTGTGGCTGGAAGG + Intergenic
1138430985 16:56969152-56969174 TTAAGGACCTTGGGGTAGGTGGG - Intronic
1139023219 16:62779141-62779163 TTCATGCCATTGTGGTTGAAAGG + Intergenic
1141335698 16:83153170-83153192 TTAAAGACAATTTGGTGGGAGGG + Intronic
1141391623 16:83669245-83669267 TTATGGTTATTATGGTTGGAGGG - Intronic
1141753040 16:85972199-85972221 TTAAGGACAATTTGGTGGGTAGG - Intergenic
1141836961 16:86547227-86547249 TTTGGGACATTTTGGTTGAAGGG - Intronic
1142950979 17:3479840-3479862 TTTAGGAAAATGTGGTTGAACGG + Intronic
1143605457 17:7982289-7982311 TTAAGGACAATTTGGTGGGTAGG + Intergenic
1143823277 17:9582610-9582632 CTAAAGACATTGTTATTGGAAGG - Intronic
1148236257 17:45971180-45971202 CTAAGGACATTCTTGGTGGAGGG + Intronic
1149361592 17:55901282-55901304 ACAAGGATATTGTGGTGGGAAGG + Intergenic
1153655707 18:7280335-7280357 AGAAGGACATTGTCATTGGAAGG + Intergenic
1156817129 18:41325014-41325036 TTATGGACAATTTGGTGGGAAGG + Intergenic
1158461192 18:57647694-57647716 TTATGTACATTATGGTTGAAAGG - Exonic
1158553679 18:58458495-58458517 TTAAGGACAAGGTGTTTGGCAGG - Intergenic
1158993704 18:62895782-62895804 TTACAGACATTTTTGTTGGATGG + Exonic
1159343866 18:67172866-67172888 TTAAGGACATTGCATTTGTATGG - Intergenic
1159502686 18:69294333-69294355 TTAATGCCATTATGGTGGGAAGG + Intergenic
1160243874 18:77141946-77141968 TTAATGCCATTGTGGGGGGAGGG - Intergenic
1160269241 18:77369082-77369104 TTAAGGACTTTGTGGTGGGAAGG - Intergenic
1160768451 19:819655-819677 TTAATGATATTGTGTTTGGGAGG + Intronic
1162434602 19:10649914-10649936 TTCAGGAAGTTCTGGTTGGATGG + Intergenic
1163492573 19:17625394-17625416 GCAAAGAGATTGTGGTTGGATGG + Intronic
925964114 2:9047566-9047588 TAAAGGACCTTGTTGTTGCAGGG - Intergenic
926436754 2:12846034-12846056 ATAGGGACATTGGGGTTGAAAGG - Intergenic
926599732 2:14829600-14829622 TTAAGCACAGTGTGGTGGGAAGG - Intergenic
928168921 2:28990942-28990964 TTAAAGACAGTGTGGGTGTATGG + Intronic
929071297 2:38033401-38033423 CTCAGAACATTGTTGTTGGAAGG + Intronic
929110444 2:38402335-38402357 TTAAGTAAATTGAGGTGGGATGG - Intergenic
929173698 2:38956887-38956909 TTCAGGACGTTCTGGATGGAGGG - Exonic
929203286 2:39260984-39261006 TTTAGGACATTAAGGCTGGAAGG + Intronic
930610303 2:53535208-53535230 TAAATGACATGGTGGTTAGAAGG - Intronic
931665482 2:64607249-64607271 CTCAGGATGTTGTGGTTGGAGGG - Intergenic
932841016 2:75082321-75082343 TTATGGACATTTGGGTTGGTTGG + Intronic
934946927 2:98549114-98549136 TAAAGAACATTGCAGTTGGAAGG - Intronic
936377421 2:111953921-111953943 TTAAGGCCATGGTGGTGGAAGGG - Intronic
937061523 2:118983516-118983538 TTATGGACAGTGTGTTTGGGAGG + Intronic
937832221 2:126436201-126436223 TCAGGGACATTGAGGTAGGAGGG - Intergenic
938786587 2:134635601-134635623 TTAATGACATTCTGGTAAGACGG - Intronic
938786770 2:134636970-134636992 TTAAGGATAATGTGGTGGGTGGG - Intronic
940259222 2:151763339-151763361 TTAAAGCCCTTGTGGTTGTACGG + Intergenic
940323492 2:152401144-152401166 TTATGGACACTGGGGTGGGATGG + Intronic
941915894 2:170813763-170813785 TAAAGGGCATTGTGGGCGGAGGG + Intronic
942145462 2:173022336-173022358 TTAAGGCCTCTGTCGTTGGAAGG + Intronic
944631182 2:201626417-201626439 TTAATGTCATGGTAGTTGGAAGG - Intronic
946051821 2:216869252-216869274 TTGAGGCCATAGTGGGTGGAGGG - Intergenic
946318975 2:218937658-218937680 TTAATTACATTGTGGTTGGCAGG + Intergenic
946513973 2:220391741-220391763 TTATGGTCAGTGTGGCTGGAAGG + Intergenic
946734248 2:222738857-222738879 TTAAAGACAATTTGGTGGGAGGG + Intergenic
947123260 2:226839459-226839481 TTAAGAACAGTGAGGTTGAAGGG + Exonic
1172866094 20:38098696-38098718 TTAAGAAAATTGTGTTTGGCTGG - Intronic
1175612274 20:60361609-60361631 TGAAGGACATGGGGGATGGAGGG + Intergenic
1176901755 21:14450769-14450791 TTACTGACAATGTAGTTGGAGGG + Intergenic
1177936643 21:27355871-27355893 TTATGGACATTGGAGGTGGAAGG - Intergenic
1178148411 21:29766223-29766245 TTAAGAACATCATGCTTGGAAGG - Intronic
1178881652 21:36454796-36454818 TTAAGGTCACTGTGGCAGGAAGG - Intergenic
1182017752 22:27055076-27055098 TTGGGGACATTGTGGGTAGAGGG - Intergenic
1182903594 22:33919488-33919510 TTTAGGACAGAGTGGTTGGTTGG - Intronic
949117478 3:345131-345153 TTTATGATATTGTGGATGGAGGG + Intronic
951633483 3:24746741-24746763 TGATTGACATAGTGGTTGGATGG + Intergenic
952154685 3:30629926-30629948 TTAAGCGCATTCTAGTTGGAGGG + Intronic
953465681 3:43117381-43117403 TCTCGGACATTGTGGTTGTAGGG - Intergenic
954085144 3:48238610-48238632 TTAAGGATAATTTGGTGGGAAGG + Intergenic
954473280 3:50718349-50718371 CTAAGGACATCTTGGTTGCATGG + Intronic
954519552 3:51212457-51212479 TTGAGGGGGTTGTGGTTGGAAGG - Intronic
954687114 3:52377017-52377039 CTCAGGAGAGTGTGGTTGGAGGG - Intronic
956324453 3:68036037-68036059 GTAAGGAAATTCTGGTGGGAAGG + Intronic
956533494 3:70249071-70249093 TCAGGGACTTTGTGGTTAGAAGG - Intergenic
957374003 3:79333619-79333641 TTCAGGATAGTGTGGGTGGATGG - Intronic
958840501 3:99198686-99198708 TTAAGAACATTGTGGTTCATGGG - Intergenic
959213583 3:103420688-103420710 TTAAATTGATTGTGGTTGGAAGG - Intergenic
960006599 3:112787511-112787533 TTAAGGACAATTTGGTGGGTGGG - Intronic
960979352 3:123207506-123207528 TTAGTGACATTGTGCTTTGATGG + Intronic
964111977 3:153097181-153097203 TTAAGGATAATTTGGTGGGAAGG - Intergenic
966236492 3:177707077-177707099 TTTAGGATTTTGTGCTTGGAGGG + Intergenic
966381106 3:179346515-179346537 TTAAGGACAATTTGGTGGGTTGG - Intergenic
968280837 3:197475552-197475574 TTATGGACACTGGGGTTGAAGGG + Intergenic
970231105 4:13912139-13912161 GGAAGGACATTGTGGTTTCAAGG - Intergenic
970650003 4:18167218-18167240 TTAAGGACAATTTGGTGGGTGGG - Intergenic
970726186 4:19047553-19047575 TCAAGGACATTGTGATGTGAAGG + Intergenic
971994251 4:33943634-33943656 CTCAGCACATTGAGGTTGGAGGG + Intergenic
972675808 4:41257933-41257955 TTAAGGCAATTGTGGACGGATGG - Intronic
972714140 4:41629183-41629205 GTAATGAGATTTTGGTTGGATGG - Intronic
973081022 4:45993239-45993261 TGAAGGACATTGTGTTTTTAGGG + Intergenic
975532396 4:75413947-75413969 TTAATTTCCTTGTGGTTGGAGGG - Intergenic
976880188 4:89912566-89912588 TTAAGGACTTTCTGGTGGCAAGG + Intronic
977509975 4:97951169-97951191 TTAAGGACAATTTGGTGGGTAGG - Intronic
978739663 4:112122369-112122391 TTAAGGAAGTTGAGGTGGGAAGG - Intergenic
981396848 4:144260605-144260627 TAAAAGACATAGTGGTTGAATGG + Intergenic
982031262 4:151303311-151303333 TCAAGAAAATGGTGGTTGGAAGG - Intronic
983045449 4:162981415-162981437 TTAAGGACATTGAGATGGGGAGG - Intergenic
984102794 4:175506309-175506331 TTTTGGACATTGAGGTTAGAGGG - Intergenic
986223599 5:5792642-5792664 TTAAGGATATTGGGGTGGTATGG + Intergenic
990788058 5:59445079-59445101 GTAAGTAAATTGTGGTGGGAAGG - Intronic
991240449 5:64452650-64452672 GAAAGGATATTGTGGTTTGAAGG - Intergenic
991534848 5:67658063-67658085 TTAATGACTTTATGGTTGGTGGG - Intergenic
993204213 5:84859983-84860005 TTAAGGTCATTGTGTTTTGGGGG + Intergenic
993272208 5:85810806-85810828 TAAACGACATTCTGTTTGGAAGG - Intergenic
993936499 5:94011347-94011369 TAAAAGACATTGTGATTAGATGG - Intronic
996215651 5:120862035-120862057 TTAAGAATATGGTGGTTGGGCGG + Intergenic
998766588 5:145495078-145495100 TTAAGGAGATAGTGGGAGGAAGG - Intronic
998987586 5:147778116-147778138 TTAATGACATAGAGGTTGGGAGG - Intronic
999718624 5:154381925-154381947 TTAAGGATCTTGTGGTGGGGAGG - Intronic
999723256 5:154414569-154414591 CTAAGGACATGGGGGTTGGTGGG + Intronic
1001242662 5:170081985-170082007 GTGAGGACATTGAGGGTGGAAGG + Intronic
1002073532 5:176694861-176694883 GAAAGGCCATAGTGGTTGGAGGG - Intergenic
1005143480 6:22661397-22661419 TTAATGGCATTGTGGCAGGAAGG + Intergenic
1007333718 6:41136022-41136044 TGAAGGACAGTGTGACTGGAGGG + Intergenic
1007466923 6:42059022-42059044 TTAAGGATAATGTGGTAGGTCGG + Intronic
1010014504 6:71088837-71088859 ATAAGGAAATTGTGGCAGGAAGG - Intergenic
1011054355 6:83190467-83190489 TTAAAGATATTGGGGTTGGGTGG - Intronic
1011491987 6:87901670-87901692 TTAAGGATAATTTGGTGGGAAGG + Intergenic
1013862300 6:114650336-114650358 ATAAGGACCTTGGGGTTGGAAGG + Intergenic
1015733854 6:136376626-136376648 TTCAGGGCATTGAGGATGGAGGG + Intronic
1017688480 6:156938221-156938243 CTAAGGTCATTGTGGTTTCAGGG + Intronic
1017795917 6:157844296-157844318 TTAAGGACAATTTGGTGGGTGGG + Intronic
1020947240 7:14627460-14627482 TTAAGGAAATTCTTATTGGAGGG + Intronic
1021167800 7:17361895-17361917 TTAAGGACATTGAGATGGGGAGG + Intergenic
1023469550 7:40499914-40499936 TGAAATACATTGTGGTTTGAGGG + Intronic
1024943550 7:54786076-54786098 CTAAGGGCAGTTTGGTTGGAAGG - Intergenic
1026494321 7:70889307-70889329 TTAGGGGAATTGAGGTTGGATGG - Intergenic
1027544099 7:79504831-79504853 TTAAGAACCTTGGGGTGGGAAGG - Intergenic
1029030400 7:97460759-97460781 TTAAGGACAATTTGGTGGGTTGG - Intergenic
1029600364 7:101559704-101559726 TTATAGACAGTGTGGTTGGGTGG - Intergenic
1030076055 7:105737828-105737850 TTAAGAATTTTGTGGCTGGAAGG + Intronic
1030339651 7:108362606-108362628 TTAAGTACATGGTTGGTGGATGG + Intronic
1030561805 7:111096392-111096414 CAAAGGACATAGTTGTTGGAAGG - Intronic
1030577715 7:111311102-111311124 TGAAGGATATTGTGGTAGAAGGG - Intronic
1030624338 7:111827763-111827785 TGGAGGATAATGTGGTTGGAAGG + Intronic
1031291649 7:119944912-119944934 TCAATGACAGTTTGGTTGGATGG + Intergenic
1031811244 7:126371971-126371993 TCCAGGACATTTTGGTTGGTAGG - Intergenic
1033737137 7:144233341-144233363 TTAATGACATTGTGATTGTTTGG + Intergenic
1033745920 7:144317605-144317627 TTAATGACATTGTGATTGTTTGG - Intergenic
1034017294 7:147600777-147600799 TTAGGGACATAGTAGTAGGAGGG - Intronic
1034067642 7:148152270-148152292 TTAAGGACAATTTGGTGGGCAGG + Intronic
1035064818 7:156096747-156096769 TTTGGGACAATGTGGCTGGAAGG + Intergenic
1035579245 8:729659-729681 TTAAGGACATTGTGGTTGGAAGG - Intronic
1035811551 8:2495731-2495753 TTAAGGACAATTTGGTGGGTGGG + Intergenic
1037224661 8:16571328-16571350 ATAAGAAGATTGTGGATGGAAGG - Intergenic
1037670297 8:21009687-21009709 TTAAGGACAATTTGGTGGGTAGG - Intergenic
1038480973 8:27901734-27901756 GTAAGGACCTTGGGGCTGGAGGG - Intronic
1041590025 8:59568023-59568045 TTCATATCATTGTGGTTGGAAGG - Intergenic
1043570657 8:81599263-81599285 TTAAAGACAATTTGGTGGGAGGG + Intergenic
1043854001 8:85244610-85244632 TTAAAGAAATTTTGGTTGGTGGG - Intronic
1044560058 8:93604061-93604083 TTAAGGTGATTGTGGGTGGTTGG - Intergenic
1045187425 8:99853288-99853310 TTCAGTACATTGTGTCTGGACGG - Intronic
1050663869 9:7913256-7913278 CTATGGACATTGTGGGTGGGTGG + Intergenic
1051371834 9:16365420-16365442 TTAAGGACAATTTGGTGGGTGGG + Intergenic
1051974670 9:22935090-22935112 TTAAGGACAATTTGGTGGGTAGG - Intergenic
1053143473 9:35696615-35696637 TTATGGACAGAGTGGCTGGATGG + Intergenic
1053450183 9:38187180-38187202 TTAAGGACAATTTGGTAGGCTGG - Intergenic
1053451110 9:38194867-38194889 TTAAGGACAATTTGGTGGGTTGG - Intergenic
1057008267 9:91580246-91580268 GTAAGGAAATTGTGGTTGAGTGG - Intronic
1058995479 9:110294642-110294664 TTAAGGACATATTGGTGGGTAGG + Intergenic
1059784479 9:117565404-117565426 AAAAGGACATTATGGTTGTATGG + Intergenic
1062088552 9:134661726-134661748 TTAAAGACATTTAGGTTGAAAGG - Intronic
1062228745 9:135469122-135469144 TTAAGGACAGCGTGGTGGGTGGG - Intergenic
1187235278 X:17461377-17461399 AAAAGGACTTTGTGTTTGGAAGG - Intronic
1187568897 X:20480978-20481000 TTAAAGACCTTGTGGTATGATGG + Intergenic
1188686482 X:33076225-33076247 TTAAGGACAATTTGGTGGGTGGG - Intronic
1189416821 X:40822642-40822664 TTAAGGACAATTTGGTAGGTAGG - Intergenic
1189619649 X:42821930-42821952 TTAAGGATAATGTGGTGGGTGGG + Intergenic
1191978696 X:66902084-66902106 CAAAGGACAATGGGGTTGGAGGG + Intergenic
1193336906 X:80300533-80300555 TCATGGACATTGTAGTAGGATGG - Intergenic
1197630385 X:128851709-128851731 TTAAATACATTGTGGTGAGATGG + Intergenic
1197842387 X:130762694-130762716 TTTATTCCATTGTGGTTGGAGGG + Intronic
1200503149 Y:3977083-3977105 TTAAGGAGATTGTCTTTGGGGGG + Intergenic