ID: 1035582675

View in Genome Browser
Species Human (GRCh38)
Location 8:749780-749802
Sequence GAGCGCGCTCTTGGTGCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035582666_1035582675 27 Left 1035582666 8:749730-749752 CCTAGGGGCTGCTATAACAAGTT No data
Right 1035582675 8:749780-749802 GAGCGCGCTCTTGGTGCTGGAGG No data
1035582669_1035582675 3 Left 1035582669 8:749754-749776 CCACAGATCGGGTGCCCGAAACG No data
Right 1035582675 8:749780-749802 GAGCGCGCTCTTGGTGCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035582675 Original CRISPR GAGCGCGCTCTTGGTGCTGG AGG Intergenic
No off target data available for this crispr