ID: 1035582770

View in Genome Browser
Species Human (GRCh38)
Location 8:750225-750247
Sequence GCCCACGGGTGGTGCCAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035582770_1035582781 10 Left 1035582770 8:750225-750247 CCACCCTGGCACCACCCGTGGGC No data
Right 1035582781 8:750258-750280 CCGCATCCTTGCCACACGAGGGG No data
1035582770_1035582782 13 Left 1035582770 8:750225-750247 CCACCCTGGCACCACCCGTGGGC No data
Right 1035582782 8:750261-750283 CATCCTTGCCACACGAGGGGAGG No data
1035582770_1035582784 19 Left 1035582770 8:750225-750247 CCACCCTGGCACCACCCGTGGGC No data
Right 1035582784 8:750267-750289 TGCCACACGAGGGGAGGTCAAGG No data
1035582770_1035582779 9 Left 1035582770 8:750225-750247 CCACCCTGGCACCACCCGTGGGC No data
Right 1035582779 8:750257-750279 GCCGCATCCTTGCCACACGAGGG No data
1035582770_1035582778 8 Left 1035582770 8:750225-750247 CCACCCTGGCACCACCCGTGGGC No data
Right 1035582778 8:750256-750278 TGCCGCATCCTTGCCACACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035582770 Original CRISPR GCCCACGGGTGGTGCCAGGG TGG (reversed) Intergenic
No off target data available for this crispr