ID: 1035582776

View in Genome Browser
Species Human (GRCh38)
Location 8:750240-750262
Sequence TGCGGCACGGCCAGTGCCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035582776_1035582788 27 Left 1035582776 8:750240-750262 CCGTGGGCACTGGCCGTGCCGCA No data
Right 1035582788 8:750290-750312 CGATTGTGCAGAGTGGGCTCAGG No data
1035582776_1035582789 28 Left 1035582776 8:750240-750262 CCGTGGGCACTGGCCGTGCCGCA No data
Right 1035582789 8:750291-750313 GATTGTGCAGAGTGGGCTCAGGG No data
1035582776_1035582786 20 Left 1035582776 8:750240-750262 CCGTGGGCACTGGCCGTGCCGCA No data
Right 1035582786 8:750283-750305 GTCAAGGCGATTGTGCAGAGTGG No data
1035582776_1035582784 4 Left 1035582776 8:750240-750262 CCGTGGGCACTGGCCGTGCCGCA No data
Right 1035582784 8:750267-750289 TGCCACACGAGGGGAGGTCAAGG No data
1035582776_1035582782 -2 Left 1035582776 8:750240-750262 CCGTGGGCACTGGCCGTGCCGCA No data
Right 1035582782 8:750261-750283 CATCCTTGCCACACGAGGGGAGG No data
1035582776_1035582779 -6 Left 1035582776 8:750240-750262 CCGTGGGCACTGGCCGTGCCGCA No data
Right 1035582779 8:750257-750279 GCCGCATCCTTGCCACACGAGGG No data
1035582776_1035582781 -5 Left 1035582776 8:750240-750262 CCGTGGGCACTGGCCGTGCCGCA No data
Right 1035582781 8:750258-750280 CCGCATCCTTGCCACACGAGGGG No data
1035582776_1035582778 -7 Left 1035582776 8:750240-750262 CCGTGGGCACTGGCCGTGCCGCA No data
Right 1035582778 8:750256-750278 TGCCGCATCCTTGCCACACGAGG No data
1035582776_1035582787 21 Left 1035582776 8:750240-750262 CCGTGGGCACTGGCCGTGCCGCA No data
Right 1035582787 8:750284-750306 TCAAGGCGATTGTGCAGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035582776 Original CRISPR TGCGGCACGGCCAGTGCCCA CGG (reversed) Intergenic
No off target data available for this crispr