ID: 1035582780

View in Genome Browser
Species Human (GRCh38)
Location 8:750258-750280
Sequence CCCCTCGTGTGGCAAGGATG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035582780_1035582788 9 Left 1035582780 8:750258-750280 CCGCATCCTTGCCACACGAGGGG No data
Right 1035582788 8:750290-750312 CGATTGTGCAGAGTGGGCTCAGG No data
1035582780_1035582790 13 Left 1035582780 8:750258-750280 CCGCATCCTTGCCACACGAGGGG No data
Right 1035582790 8:750294-750316 TGTGCAGAGTGGGCTCAGGGAGG No data
1035582780_1035582789 10 Left 1035582780 8:750258-750280 CCGCATCCTTGCCACACGAGGGG No data
Right 1035582789 8:750291-750313 GATTGTGCAGAGTGGGCTCAGGG No data
1035582780_1035582791 23 Left 1035582780 8:750258-750280 CCGCATCCTTGCCACACGAGGGG No data
Right 1035582791 8:750304-750326 GGGCTCAGGGAGGACGTCACAGG No data
1035582780_1035582787 3 Left 1035582780 8:750258-750280 CCGCATCCTTGCCACACGAGGGG No data
Right 1035582787 8:750284-750306 TCAAGGCGATTGTGCAGAGTGGG No data
1035582780_1035582786 2 Left 1035582780 8:750258-750280 CCGCATCCTTGCCACACGAGGGG No data
Right 1035582786 8:750283-750305 GTCAAGGCGATTGTGCAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035582780 Original CRISPR CCCCTCGTGTGGCAAGGATG CGG (reversed) Intergenic
No off target data available for this crispr