ID: 1035582782

View in Genome Browser
Species Human (GRCh38)
Location 8:750261-750283
Sequence CATCCTTGCCACACGAGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035582774_1035582782 2 Left 1035582774 8:750236-750258 CCACCCGTGGGCACTGGCCGTGC No data
Right 1035582782 8:750261-750283 CATCCTTGCCACACGAGGGGAGG No data
1035582771_1035582782 10 Left 1035582771 8:750228-750250 CCCTGGCACCACCCGTGGGCACT No data
Right 1035582782 8:750261-750283 CATCCTTGCCACACGAGGGGAGG No data
1035582770_1035582782 13 Left 1035582770 8:750225-750247 CCACCCTGGCACCACCCGTGGGC No data
Right 1035582782 8:750261-750283 CATCCTTGCCACACGAGGGGAGG No data
1035582776_1035582782 -2 Left 1035582776 8:750240-750262 CCGTGGGCACTGGCCGTGCCGCA No data
Right 1035582782 8:750261-750283 CATCCTTGCCACACGAGGGGAGG No data
1035582775_1035582782 -1 Left 1035582775 8:750239-750261 CCCGTGGGCACTGGCCGTGCCGC No data
Right 1035582782 8:750261-750283 CATCCTTGCCACACGAGGGGAGG No data
1035582772_1035582782 9 Left 1035582772 8:750229-750251 CCTGGCACCACCCGTGGGCACTG No data
Right 1035582782 8:750261-750283 CATCCTTGCCACACGAGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035582782 Original CRISPR CATCCTTGCCACACGAGGGG AGG Intergenic
No off target data available for this crispr