ID: 1035582785

View in Genome Browser
Species Human (GRCh38)
Location 8:750269-750291
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035582785_1035582790 2 Left 1035582785 8:750269-750291 CCACACGAGGGGAGGTCAAGGCG No data
Right 1035582790 8:750294-750316 TGTGCAGAGTGGGCTCAGGGAGG No data
1035582785_1035582787 -8 Left 1035582785 8:750269-750291 CCACACGAGGGGAGGTCAAGGCG No data
Right 1035582787 8:750284-750306 TCAAGGCGATTGTGCAGAGTGGG No data
1035582785_1035582786 -9 Left 1035582785 8:750269-750291 CCACACGAGGGGAGGTCAAGGCG No data
Right 1035582786 8:750283-750305 GTCAAGGCGATTGTGCAGAGTGG No data
1035582785_1035582789 -1 Left 1035582785 8:750269-750291 CCACACGAGGGGAGGTCAAGGCG No data
Right 1035582789 8:750291-750313 GATTGTGCAGAGTGGGCTCAGGG No data
1035582785_1035582788 -2 Left 1035582785 8:750269-750291 CCACACGAGGGGAGGTCAAGGCG No data
Right 1035582788 8:750290-750312 CGATTGTGCAGAGTGGGCTCAGG No data
1035582785_1035582791 12 Left 1035582785 8:750269-750291 CCACACGAGGGGAGGTCAAGGCG No data
Right 1035582791 8:750304-750326 GGGCTCAGGGAGGACGTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035582785 Original CRISPR CGCCTTGACCTCCCCTCGTG TGG (reversed) Intergenic
No off target data available for this crispr