ID: 1035582786

View in Genome Browser
Species Human (GRCh38)
Location 8:750283-750305
Sequence GTCAAGGCGATTGTGCAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035582777_1035582786 7 Left 1035582777 8:750253-750275 CCGTGCCGCATCCTTGCCACACG No data
Right 1035582786 8:750283-750305 GTCAAGGCGATTGTGCAGAGTGG No data
1035582776_1035582786 20 Left 1035582776 8:750240-750262 CCGTGGGCACTGGCCGTGCCGCA No data
Right 1035582786 8:750283-750305 GTCAAGGCGATTGTGCAGAGTGG No data
1035582780_1035582786 2 Left 1035582780 8:750258-750280 CCGCATCCTTGCCACACGAGGGG No data
Right 1035582786 8:750283-750305 GTCAAGGCGATTGTGCAGAGTGG No data
1035582785_1035582786 -9 Left 1035582785 8:750269-750291 CCACACGAGGGGAGGTCAAGGCG No data
Right 1035582786 8:750283-750305 GTCAAGGCGATTGTGCAGAGTGG No data
1035582774_1035582786 24 Left 1035582774 8:750236-750258 CCACCCGTGGGCACTGGCCGTGC No data
Right 1035582786 8:750283-750305 GTCAAGGCGATTGTGCAGAGTGG No data
1035582775_1035582786 21 Left 1035582775 8:750239-750261 CCCGTGGGCACTGGCCGTGCCGC No data
Right 1035582786 8:750283-750305 GTCAAGGCGATTGTGCAGAGTGG No data
1035582783_1035582786 -4 Left 1035582783 8:750264-750286 CCTTGCCACACGAGGGGAGGTCA No data
Right 1035582786 8:750283-750305 GTCAAGGCGATTGTGCAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035582786 Original CRISPR GTCAAGGCGATTGTGCAGAG TGG Intergenic
No off target data available for this crispr