ID: 1035582787

View in Genome Browser
Species Human (GRCh38)
Location 8:750284-750306
Sequence TCAAGGCGATTGTGCAGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035582783_1035582787 -3 Left 1035582783 8:750264-750286 CCTTGCCACACGAGGGGAGGTCA No data
Right 1035582787 8:750284-750306 TCAAGGCGATTGTGCAGAGTGGG No data
1035582775_1035582787 22 Left 1035582775 8:750239-750261 CCCGTGGGCACTGGCCGTGCCGC No data
Right 1035582787 8:750284-750306 TCAAGGCGATTGTGCAGAGTGGG No data
1035582776_1035582787 21 Left 1035582776 8:750240-750262 CCGTGGGCACTGGCCGTGCCGCA No data
Right 1035582787 8:750284-750306 TCAAGGCGATTGTGCAGAGTGGG No data
1035582785_1035582787 -8 Left 1035582785 8:750269-750291 CCACACGAGGGGAGGTCAAGGCG No data
Right 1035582787 8:750284-750306 TCAAGGCGATTGTGCAGAGTGGG No data
1035582780_1035582787 3 Left 1035582780 8:750258-750280 CCGCATCCTTGCCACACGAGGGG No data
Right 1035582787 8:750284-750306 TCAAGGCGATTGTGCAGAGTGGG No data
1035582774_1035582787 25 Left 1035582774 8:750236-750258 CCACCCGTGGGCACTGGCCGTGC No data
Right 1035582787 8:750284-750306 TCAAGGCGATTGTGCAGAGTGGG No data
1035582777_1035582787 8 Left 1035582777 8:750253-750275 CCGTGCCGCATCCTTGCCACACG No data
Right 1035582787 8:750284-750306 TCAAGGCGATTGTGCAGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035582787 Original CRISPR TCAAGGCGATTGTGCAGAGT GGG Intergenic
No off target data available for this crispr