ID: 1035582790

View in Genome Browser
Species Human (GRCh38)
Location 8:750294-750316
Sequence TGTGCAGAGTGGGCTCAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035582777_1035582790 18 Left 1035582777 8:750253-750275 CCGTGCCGCATCCTTGCCACACG No data
Right 1035582790 8:750294-750316 TGTGCAGAGTGGGCTCAGGGAGG No data
1035582780_1035582790 13 Left 1035582780 8:750258-750280 CCGCATCCTTGCCACACGAGGGG No data
Right 1035582790 8:750294-750316 TGTGCAGAGTGGGCTCAGGGAGG No data
1035582783_1035582790 7 Left 1035582783 8:750264-750286 CCTTGCCACACGAGGGGAGGTCA No data
Right 1035582790 8:750294-750316 TGTGCAGAGTGGGCTCAGGGAGG No data
1035582785_1035582790 2 Left 1035582785 8:750269-750291 CCACACGAGGGGAGGTCAAGGCG No data
Right 1035582790 8:750294-750316 TGTGCAGAGTGGGCTCAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035582790 Original CRISPR TGTGCAGAGTGGGCTCAGGG AGG Intergenic
No off target data available for this crispr