ID: 1035582791

View in Genome Browser
Species Human (GRCh38)
Location 8:750304-750326
Sequence GGGCTCAGGGAGGACGTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035582783_1035582791 17 Left 1035582783 8:750264-750286 CCTTGCCACACGAGGGGAGGTCA No data
Right 1035582791 8:750304-750326 GGGCTCAGGGAGGACGTCACAGG No data
1035582777_1035582791 28 Left 1035582777 8:750253-750275 CCGTGCCGCATCCTTGCCACACG No data
Right 1035582791 8:750304-750326 GGGCTCAGGGAGGACGTCACAGG No data
1035582785_1035582791 12 Left 1035582785 8:750269-750291 CCACACGAGGGGAGGTCAAGGCG No data
Right 1035582791 8:750304-750326 GGGCTCAGGGAGGACGTCACAGG No data
1035582780_1035582791 23 Left 1035582780 8:750258-750280 CCGCATCCTTGCCACACGAGGGG No data
Right 1035582791 8:750304-750326 GGGCTCAGGGAGGACGTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035582791 Original CRISPR GGGCTCAGGGAGGACGTCAC AGG Intergenic
No off target data available for this crispr