ID: 1035582885

View in Genome Browser
Species Human (GRCh38)
Location 8:751101-751123
Sequence CCTTCCCGTGAGAGGGTGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035582885_1035582891 -2 Left 1035582885 8:751101-751123 CCGGCCACCCTCTCACGGGAAGG No data
Right 1035582891 8:751122-751144 GGAGCATTTTCCTGGATCTCCGG No data
1035582885_1035582890 -10 Left 1035582885 8:751101-751123 CCGGCCACCCTCTCACGGGAAGG No data
Right 1035582890 8:751114-751136 CACGGGAAGGAGCATTTTCCTGG No data
1035582885_1035582896 17 Left 1035582885 8:751101-751123 CCGGCCACCCTCTCACGGGAAGG No data
Right 1035582896 8:751141-751163 CCGGCCACCCTCTCACGGGAAGG No data
1035582885_1035582894 13 Left 1035582885 8:751101-751123 CCGGCCACCCTCTCACGGGAAGG No data
Right 1035582894 8:751137-751159 ATCTCCGGCCACCCTCTCACGGG No data
1035582885_1035582893 12 Left 1035582885 8:751101-751123 CCGGCCACCCTCTCACGGGAAGG No data
Right 1035582893 8:751136-751158 GATCTCCGGCCACCCTCTCACGG No data
1035582885_1035582900 30 Left 1035582885 8:751101-751123 CCGGCCACCCTCTCACGGGAAGG No data
Right 1035582900 8:751154-751176 CACGGGAAGGAGCATTTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035582885 Original CRISPR CCTTCCCGTGAGAGGGTGGC CGG (reversed) Intergenic
No off target data available for this crispr