ID: 1035582895

View in Genome Browser
Species Human (GRCh38)
Location 8:751141-751163
Sequence CCTTCCCGTGAGAGGGTGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035582895_1035582903 12 Left 1035582895 8:751141-751163 CCGGCCACCCTCTCACGGGAAGG No data
Right 1035582903 8:751176-751198 GATCTCCGGCCACCCTCTCACGG No data
1035582895_1035582906 17 Left 1035582895 8:751141-751163 CCGGCCACCCTCTCACGGGAAGG No data
Right 1035582906 8:751181-751203 CCGGCCACCCTCTCACGGGAAGG No data
1035582895_1035582900 -10 Left 1035582895 8:751141-751163 CCGGCCACCCTCTCACGGGAAGG No data
Right 1035582900 8:751154-751176 CACGGGAAGGAGCATTTTCCTGG No data
1035582895_1035582904 13 Left 1035582895 8:751141-751163 CCGGCCACCCTCTCACGGGAAGG No data
Right 1035582904 8:751177-751199 ATCTCCGGCCACCCTCTCACGGG No data
1035582895_1035582901 -2 Left 1035582895 8:751141-751163 CCGGCCACCCTCTCACGGGAAGG No data
Right 1035582901 8:751162-751184 GGAGCATTTTCCTGGATCTCCGG No data
1035582895_1035582910 30 Left 1035582895 8:751141-751163 CCGGCCACCCTCTCACGGGAAGG No data
Right 1035582910 8:751194-751216 CACGGGAAGGAGCATTTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035582895 Original CRISPR CCTTCCCGTGAGAGGGTGGC CGG (reversed) Intergenic
No off target data available for this crispr