ID: 1035583353

View in Genome Browser
Species Human (GRCh38)
Location 8:753945-753967
Sequence TGCACCTGACACCGCGCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035583353_1035583360 25 Left 1035583353 8:753945-753967 CCCTGGGCGCGGTGTCAGGTGCA No data
Right 1035583360 8:753993-754015 GCCTTCTTGTCTACCTTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035583353 Original CRISPR TGCACCTGACACCGCGCCCA GGG (reversed) Intergenic