ID: 1035586932

View in Genome Browser
Species Human (GRCh38)
Location 8:783746-783768
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035586932_1035586939 -3 Left 1035586932 8:783746-783768 CCTCCCACCACATCCGGAATCTT No data
Right 1035586939 8:783766-783788 CTTGCAGGGAGTGTTGCCCTTGG No data
1035586932_1035586946 23 Left 1035586932 8:783746-783768 CCTCCCACCACATCCGGAATCTT No data
Right 1035586946 8:783792-783814 TCAGAACAATGGAGAGTTTGGGG No data
1035586932_1035586941 12 Left 1035586932 8:783746-783768 CCTCCCACCACATCCGGAATCTT No data
Right 1035586941 8:783781-783803 GCCCTTGGGTGTCAGAACAATGG No data
1035586932_1035586945 22 Left 1035586932 8:783746-783768 CCTCCCACCACATCCGGAATCTT No data
Right 1035586945 8:783791-783813 GTCAGAACAATGGAGAGTTTGGG No data
1035586932_1035586940 -2 Left 1035586932 8:783746-783768 CCTCCCACCACATCCGGAATCTT No data
Right 1035586940 8:783767-783789 TTGCAGGGAGTGTTGCCCTTGGG No data
1035586932_1035586944 21 Left 1035586932 8:783746-783768 CCTCCCACCACATCCGGAATCTT No data
Right 1035586944 8:783790-783812 TGTCAGAACAATGGAGAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035586932 Original CRISPR AAGATTCCGGATGTGGTGGG AGG (reversed) Intergenic
No off target data available for this crispr