ID: 1035586933

View in Genome Browser
Species Human (GRCh38)
Location 8:783749-783771
Sequence TGCAAGATTCCGGATGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035586933_1035586946 20 Left 1035586933 8:783749-783771 CCCACCACATCCGGAATCTTGCA No data
Right 1035586946 8:783792-783814 TCAGAACAATGGAGAGTTTGGGG No data
1035586933_1035586941 9 Left 1035586933 8:783749-783771 CCCACCACATCCGGAATCTTGCA No data
Right 1035586941 8:783781-783803 GCCCTTGGGTGTCAGAACAATGG No data
1035586933_1035586940 -5 Left 1035586933 8:783749-783771 CCCACCACATCCGGAATCTTGCA No data
Right 1035586940 8:783767-783789 TTGCAGGGAGTGTTGCCCTTGGG No data
1035586933_1035586939 -6 Left 1035586933 8:783749-783771 CCCACCACATCCGGAATCTTGCA No data
Right 1035586939 8:783766-783788 CTTGCAGGGAGTGTTGCCCTTGG No data
1035586933_1035586945 19 Left 1035586933 8:783749-783771 CCCACCACATCCGGAATCTTGCA No data
Right 1035586945 8:783791-783813 GTCAGAACAATGGAGAGTTTGGG No data
1035586933_1035586944 18 Left 1035586933 8:783749-783771 CCCACCACATCCGGAATCTTGCA No data
Right 1035586944 8:783790-783812 TGTCAGAACAATGGAGAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035586933 Original CRISPR TGCAAGATTCCGGATGTGGT GGG (reversed) Intergenic
No off target data available for this crispr