ID: 1035586937

View in Genome Browser
Species Human (GRCh38)
Location 8:783753-783775
Sequence TCCCTGCAAGATTCCGGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035586937_1035586940 -9 Left 1035586937 8:783753-783775 CCACATCCGGAATCTTGCAGGGA No data
Right 1035586940 8:783767-783789 TTGCAGGGAGTGTTGCCCTTGGG No data
1035586937_1035586946 16 Left 1035586937 8:783753-783775 CCACATCCGGAATCTTGCAGGGA No data
Right 1035586946 8:783792-783814 TCAGAACAATGGAGAGTTTGGGG No data
1035586937_1035586941 5 Left 1035586937 8:783753-783775 CCACATCCGGAATCTTGCAGGGA No data
Right 1035586941 8:783781-783803 GCCCTTGGGTGTCAGAACAATGG No data
1035586937_1035586944 14 Left 1035586937 8:783753-783775 CCACATCCGGAATCTTGCAGGGA No data
Right 1035586944 8:783790-783812 TGTCAGAACAATGGAGAGTTTGG No data
1035586937_1035586939 -10 Left 1035586937 8:783753-783775 CCACATCCGGAATCTTGCAGGGA No data
Right 1035586939 8:783766-783788 CTTGCAGGGAGTGTTGCCCTTGG No data
1035586937_1035586945 15 Left 1035586937 8:783753-783775 CCACATCCGGAATCTTGCAGGGA No data
Right 1035586945 8:783791-783813 GTCAGAACAATGGAGAGTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035586937 Original CRISPR TCCCTGCAAGATTCCGGATG TGG (reversed) Intergenic
No off target data available for this crispr