ID: 1035586938

View in Genome Browser
Species Human (GRCh38)
Location 8:783759-783781
Sequence CAACACTCCCTGCAAGATTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035586938_1035586945 9 Left 1035586938 8:783759-783781 CCGGAATCTTGCAGGGAGTGTTG No data
Right 1035586945 8:783791-783813 GTCAGAACAATGGAGAGTTTGGG No data
1035586938_1035586947 28 Left 1035586938 8:783759-783781 CCGGAATCTTGCAGGGAGTGTTG No data
Right 1035586947 8:783810-783832 TGGGGTATCTGTCTCACTGCTGG No data
1035586938_1035586946 10 Left 1035586938 8:783759-783781 CCGGAATCTTGCAGGGAGTGTTG No data
Right 1035586946 8:783792-783814 TCAGAACAATGGAGAGTTTGGGG No data
1035586938_1035586941 -1 Left 1035586938 8:783759-783781 CCGGAATCTTGCAGGGAGTGTTG No data
Right 1035586941 8:783781-783803 GCCCTTGGGTGTCAGAACAATGG No data
1035586938_1035586944 8 Left 1035586938 8:783759-783781 CCGGAATCTTGCAGGGAGTGTTG No data
Right 1035586944 8:783790-783812 TGTCAGAACAATGGAGAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035586938 Original CRISPR CAACACTCCCTGCAAGATTC CGG (reversed) Intergenic
No off target data available for this crispr