ID: 1035586939

View in Genome Browser
Species Human (GRCh38)
Location 8:783766-783788
Sequence CTTGCAGGGAGTGTTGCCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035586927_1035586939 26 Left 1035586927 8:783717-783739 CCCTCTTATGAAAGAGGGAAAAG No data
Right 1035586939 8:783766-783788 CTTGCAGGGAGTGTTGCCCTTGG No data
1035586933_1035586939 -6 Left 1035586933 8:783749-783771 CCCACCACATCCGGAATCTTGCA No data
Right 1035586939 8:783766-783788 CTTGCAGGGAGTGTTGCCCTTGG No data
1035586928_1035586939 25 Left 1035586928 8:783718-783740 CCTCTTATGAAAGAGGGAAAAGG No data
Right 1035586939 8:783766-783788 CTTGCAGGGAGTGTTGCCCTTGG No data
1035586934_1035586939 -7 Left 1035586934 8:783750-783772 CCACCACATCCGGAATCTTGCAG No data
Right 1035586939 8:783766-783788 CTTGCAGGGAGTGTTGCCCTTGG No data
1035586931_1035586939 -2 Left 1035586931 8:783745-783767 CCCTCCCACCACATCCGGAATCT No data
Right 1035586939 8:783766-783788 CTTGCAGGGAGTGTTGCCCTTGG No data
1035586932_1035586939 -3 Left 1035586932 8:783746-783768 CCTCCCACCACATCCGGAATCTT No data
Right 1035586939 8:783766-783788 CTTGCAGGGAGTGTTGCCCTTGG No data
1035586937_1035586939 -10 Left 1035586937 8:783753-783775 CCACATCCGGAATCTTGCAGGGA No data
Right 1035586939 8:783766-783788 CTTGCAGGGAGTGTTGCCCTTGG No data
1035586925_1035586939 28 Left 1035586925 8:783715-783737 CCCCCTCTTATGAAAGAGGGAAA No data
Right 1035586939 8:783766-783788 CTTGCAGGGAGTGTTGCCCTTGG No data
1035586926_1035586939 27 Left 1035586926 8:783716-783738 CCCCTCTTATGAAAGAGGGAAAA No data
Right 1035586939 8:783766-783788 CTTGCAGGGAGTGTTGCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035586939 Original CRISPR CTTGCAGGGAGTGTTGCCCT TGG Intergenic
No off target data available for this crispr