ID: 1035586944

View in Genome Browser
Species Human (GRCh38)
Location 8:783790-783812
Sequence TGTCAGAACAATGGAGAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035586934_1035586944 17 Left 1035586934 8:783750-783772 CCACCACATCCGGAATCTTGCAG No data
Right 1035586944 8:783790-783812 TGTCAGAACAATGGAGAGTTTGG No data
1035586937_1035586944 14 Left 1035586937 8:783753-783775 CCACATCCGGAATCTTGCAGGGA No data
Right 1035586944 8:783790-783812 TGTCAGAACAATGGAGAGTTTGG No data
1035586933_1035586944 18 Left 1035586933 8:783749-783771 CCCACCACATCCGGAATCTTGCA No data
Right 1035586944 8:783790-783812 TGTCAGAACAATGGAGAGTTTGG No data
1035586938_1035586944 8 Left 1035586938 8:783759-783781 CCGGAATCTTGCAGGGAGTGTTG No data
Right 1035586944 8:783790-783812 TGTCAGAACAATGGAGAGTTTGG No data
1035586931_1035586944 22 Left 1035586931 8:783745-783767 CCCTCCCACCACATCCGGAATCT No data
Right 1035586944 8:783790-783812 TGTCAGAACAATGGAGAGTTTGG No data
1035586932_1035586944 21 Left 1035586932 8:783746-783768 CCTCCCACCACATCCGGAATCTT No data
Right 1035586944 8:783790-783812 TGTCAGAACAATGGAGAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035586944 Original CRISPR TGTCAGAACAATGGAGAGTT TGG Intergenic
No off target data available for this crispr