ID: 1035586946

View in Genome Browser
Species Human (GRCh38)
Location 8:783792-783814
Sequence TCAGAACAATGGAGAGTTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035586934_1035586946 19 Left 1035586934 8:783750-783772 CCACCACATCCGGAATCTTGCAG No data
Right 1035586946 8:783792-783814 TCAGAACAATGGAGAGTTTGGGG No data
1035586931_1035586946 24 Left 1035586931 8:783745-783767 CCCTCCCACCACATCCGGAATCT No data
Right 1035586946 8:783792-783814 TCAGAACAATGGAGAGTTTGGGG No data
1035586938_1035586946 10 Left 1035586938 8:783759-783781 CCGGAATCTTGCAGGGAGTGTTG No data
Right 1035586946 8:783792-783814 TCAGAACAATGGAGAGTTTGGGG No data
1035586932_1035586946 23 Left 1035586932 8:783746-783768 CCTCCCACCACATCCGGAATCTT No data
Right 1035586946 8:783792-783814 TCAGAACAATGGAGAGTTTGGGG No data
1035586933_1035586946 20 Left 1035586933 8:783749-783771 CCCACCACATCCGGAATCTTGCA No data
Right 1035586946 8:783792-783814 TCAGAACAATGGAGAGTTTGGGG No data
1035586937_1035586946 16 Left 1035586937 8:783753-783775 CCACATCCGGAATCTTGCAGGGA No data
Right 1035586946 8:783792-783814 TCAGAACAATGGAGAGTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035586946 Original CRISPR TCAGAACAATGGAGAGTTTG GGG Intergenic
No off target data available for this crispr