ID: 1035589485

View in Genome Browser
Species Human (GRCh38)
Location 8:802091-802113
Sequence AGGTGTGTGGACCATTCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035589485_1035589493 5 Left 1035589485 8:802091-802113 CCTGGGGAATGGTCCACACACCT No data
Right 1035589493 8:802119-802141 GCCCTCCGTCCTCACGGCCTGGG No data
1035589485_1035589495 6 Left 1035589485 8:802091-802113 CCTGGGGAATGGTCCACACACCT No data
Right 1035589495 8:802120-802142 CCCTCCGTCCTCACGGCCTGGGG No data
1035589485_1035589501 27 Left 1035589485 8:802091-802113 CCTGGGGAATGGTCCACACACCT No data
Right 1035589501 8:802141-802163 GGAATGGTCCGCACTCCTCCTGG No data
1035589485_1035589498 11 Left 1035589485 8:802091-802113 CCTGGGGAATGGTCCACACACCT No data
Right 1035589498 8:802125-802147 CGTCCTCACGGCCTGGGGAATGG No data
1035589485_1035589502 28 Left 1035589485 8:802091-802113 CCTGGGGAATGGTCCACACACCT No data
Right 1035589502 8:802142-802164 GAATGGTCCGCACTCCTCCTGGG No data
1035589485_1035589490 -1 Left 1035589485 8:802091-802113 CCTGGGGAATGGTCCACACACCT No data
Right 1035589490 8:802113-802135 TCCTGGGCCCTCCGTCCTCACGG No data
1035589485_1035589492 4 Left 1035589485 8:802091-802113 CCTGGGGAATGGTCCACACACCT No data
Right 1035589492 8:802118-802140 GGCCCTCCGTCCTCACGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035589485 Original CRISPR AGGTGTGTGGACCATTCCCC AGG (reversed) Intergenic
No off target data available for this crispr