ID: 1035590765

View in Genome Browser
Species Human (GRCh38)
Location 8:811575-811597
Sequence TCTCACCATGGCAGGAGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035590765_1035590772 15 Left 1035590765 8:811575-811597 CCAGGGCTCCTGCCATGGTGAGA No data
Right 1035590772 8:811613-811635 GATGAAGCTCCCATCAACCTTGG No data
1035590765_1035590775 25 Left 1035590765 8:811575-811597 CCAGGGCTCCTGCCATGGTGAGA No data
Right 1035590775 8:811623-811645 CCATCAACCTTGGAATGAGCAGG No data
1035590765_1035590769 -7 Left 1035590765 8:811575-811597 CCAGGGCTCCTGCCATGGTGAGA No data
Right 1035590769 8:811591-811613 GGTGAGAGGCCACCAGCTTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035590765 Original CRISPR TCTCACCATGGCAGGAGCCC TGG (reversed) Intergenic
No off target data available for this crispr