ID: 1035592342

View in Genome Browser
Species Human (GRCh38)
Location 8:825406-825428
Sequence CACAGAAGCTGGCCTCTGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035592339_1035592342 -3 Left 1035592339 8:825386-825408 CCTGGGTGTGGAGGCTGTTCCAC No data
Right 1035592342 8:825406-825428 CACAGAAGCTGGCCTCTGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035592342 Original CRISPR CACAGAAGCTGGCCTCTGCC CGG Intergenic
No off target data available for this crispr