ID: 1035596574

View in Genome Browser
Species Human (GRCh38)
Location 8:862793-862815
Sequence CTCAGTCAACACCAGACTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035596574_1035596579 3 Left 1035596574 8:862793-862815 CCCAAAGTCTGGTGTTGACTGAG No data
Right 1035596579 8:862819-862841 GCACTGCTGACATGGGACTGTGG No data
1035596574_1035596577 -5 Left 1035596574 8:862793-862815 CCCAAAGTCTGGTGTTGACTGAG No data
Right 1035596577 8:862811-862833 CTGAGGATGCACTGCTGACATGG No data
1035596574_1035596581 7 Left 1035596574 8:862793-862815 CCCAAAGTCTGGTGTTGACTGAG No data
Right 1035596581 8:862823-862845 TGCTGACATGGGACTGTGGGAGG No data
1035596574_1035596578 -4 Left 1035596574 8:862793-862815 CCCAAAGTCTGGTGTTGACTGAG No data
Right 1035596578 8:862812-862834 TGAGGATGCACTGCTGACATGGG No data
1035596574_1035596580 4 Left 1035596574 8:862793-862815 CCCAAAGTCTGGTGTTGACTGAG No data
Right 1035596580 8:862820-862842 CACTGCTGACATGGGACTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035596574 Original CRISPR CTCAGTCAACACCAGACTTT GGG (reversed) Intergenic
No off target data available for this crispr