ID: 1035598177

View in Genome Browser
Species Human (GRCh38)
Location 8:878090-878112
Sequence GAGGACTCCCAGTACTCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035598177_1035598178 -8 Left 1035598177 8:878090-878112 CCTTGAGAGTACTGGGAGTCCTC No data
Right 1035598178 8:878105-878127 GAGTCCTCATACTGTCATGCTGG No data
1035598177_1035598180 20 Left 1035598177 8:878090-878112 CCTTGAGAGTACTGGGAGTCCTC No data
Right 1035598180 8:878133-878155 ACTCTCCCATTTTTTAACAATGG No data
1035598177_1035598181 21 Left 1035598177 8:878090-878112 CCTTGAGAGTACTGGGAGTCCTC No data
Right 1035598181 8:878134-878156 CTCTCCCATTTTTTAACAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035598177 Original CRISPR GAGGACTCCCAGTACTCTCA AGG (reversed) Intergenic
No off target data available for this crispr