ID: 1035599612

View in Genome Browser
Species Human (GRCh38)
Location 8:889877-889899
Sequence CTTGCAAACTCACGCCACTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035599612_1035599619 6 Left 1035599612 8:889877-889899 CCCCAGTGGCGTGAGTTTGCAAG No data
Right 1035599619 8:889906-889928 CTTCTGATCCGTGGGTTGCACGG No data
1035599612_1035599618 -2 Left 1035599612 8:889877-889899 CCCCAGTGGCGTGAGTTTGCAAG No data
Right 1035599618 8:889898-889920 AGTGGGATCTTCTGATCCGTGGG 0: 8
1: 59
2: 94
3: 114
4: 190
1035599612_1035599621 14 Left 1035599612 8:889877-889899 CCCCAGTGGCGTGAGTTTGCAAG No data
Right 1035599621 8:889914-889936 CCGTGGGTTGCACGGTTTTGTGG No data
1035599612_1035599622 15 Left 1035599612 8:889877-889899 CCCCAGTGGCGTGAGTTTGCAAG No data
Right 1035599622 8:889915-889937 CGTGGGTTGCACGGTTTTGTGGG No data
1035599612_1035599617 -3 Left 1035599612 8:889877-889899 CCCCAGTGGCGTGAGTTTGCAAG No data
Right 1035599617 8:889897-889919 AAGTGGGATCTTCTGATCCGTGG 0: 5
1: 23
2: 80
3: 98
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035599612 Original CRISPR CTTGCAAACTCACGCCACTG GGG (reversed) Intergenic
No off target data available for this crispr