ID: 1035599617

View in Genome Browser
Species Human (GRCh38)
Location 8:889897-889919
Sequence AAGTGGGATCTTCTGATCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 391
Summary {0: 5, 1: 23, 2: 80, 3: 98, 4: 185}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035599613_1035599617 -4 Left 1035599613 8:889878-889900 CCCAGTGGCGTGAGTTTGCAAGT No data
Right 1035599617 8:889897-889919 AAGTGGGATCTTCTGATCCGTGG 0: 5
1: 23
2: 80
3: 98
4: 185
1035599614_1035599617 -5 Left 1035599614 8:889879-889901 CCAGTGGCGTGAGTTTGCAAGTG No data
Right 1035599617 8:889897-889919 AAGTGGGATCTTCTGATCCGTGG 0: 5
1: 23
2: 80
3: 98
4: 185
1035599612_1035599617 -3 Left 1035599612 8:889877-889899 CCCCAGTGGCGTGAGTTTGCAAG No data
Right 1035599617 8:889897-889919 AAGTGGGATCTTCTGATCCGTGG 0: 5
1: 23
2: 80
3: 98
4: 185
1035599610_1035599617 16 Left 1035599610 8:889858-889880 CCGGGGCTGGAACTGTAGGCCCC No data
Right 1035599617 8:889897-889919 AAGTGGGATCTTCTGATCCGTGG 0: 5
1: 23
2: 80
3: 98
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035599617 Original CRISPR AAGTGGGATCTTCTGATCCG TGG Intergenic
902547609 1:17199733-17199755 CTGTGGGCTCTTCTGGTCCGGGG - Intergenic
903761805 1:25703697-25703719 AAGTGGGATCTGCAGATGGGAGG + Intronic
905637155 1:39561968-39561990 AAGTGGGATCTGCTGCCCCCAGG - Intronic
907607967 1:55838596-55838618 AAGTAGTTTCTTCTGATCAGTGG + Intergenic
909697452 1:78483868-78483890 AAGTGGGATCTTCCAGTCCATGG - Intronic
909797079 1:79754428-79754450 AGGTGGGATCACCTGATCCTGGG + Intergenic
910518404 1:88088841-88088863 GAGTGGGATCTTCCGATCTGTGG + Intergenic
910619425 1:89236440-89236462 TAGTGGGATCTCCTGATACGTGG + Intergenic
911242711 1:95483168-95483190 TAGTGGGATCTTCTGATCTGTGG - Intergenic
914218540 1:145656302-145656324 AAGGGGAATCTCCTGATCCACGG + Intronic
914400549 1:147316344-147316366 GAGTGGGATCTTCTAATCCATGG - Intergenic
914471099 1:147978993-147979015 AAGGGGAATCTCCTGATCCACGG + Intronic
914925820 1:151885779-151885801 AAGTGGGATATTTGGATCAGAGG + Intronic
916916823 1:169416127-169416149 TAGTGGGATCTTCTGATCCATGG + Intronic
917024937 1:170631480-170631502 AAGTGGGATCTTCCGATCCGTGG + Intergenic
917060639 1:171033401-171033423 GAATGGGATCTTCCAATCCGTGG + Intronic
917356516 1:174131592-174131614 GAGTGGGATCTTCTGATCTGTGG + Intergenic
918168664 1:181974841-181974863 AAGTGGGATCTTCTGATCCGTGG - Intergenic
918697389 1:187560795-187560817 GAATGTGATCTTCTGATCCGTGG + Intergenic
918943098 1:191026886-191026908 GAGTGGGATCTTCTGATGCACGG - Intergenic
919231375 1:194779277-194779299 GAGGGGGATCTCCTGATCTGCGG - Intergenic
920080345 1:203368512-203368534 AATTGGGATCTTCTGTCCCTGGG + Intergenic
921097165 1:211896522-211896544 CAGTGGGCTCTTCAGATCTGTGG + Intergenic
922399700 1:225239324-225239346 ACGGGGGATCTCCTGATCTGTGG + Intronic
922693547 1:227713625-227713647 GAGTGGGATCTTCCGATCCGTGG - Intergenic
924779183 1:247131307-247131329 GAGTGGGATCTTCCAATCCGTGG - Intronic
1062822189 10:542638-542660 AACTGGGATCTGATGATCTGTGG - Intronic
1062822239 10:542850-542872 AACTGGGATCTGATGATCTGTGG - Intronic
1063211663 10:3886385-3886407 AGGAGGGCTCTTCAGATCCGCGG - Intergenic
1066525532 10:36274960-36274982 GAGTGGGATCTCCTGATCTTTGG - Intergenic
1068126945 10:52851743-52851765 AAGTGGGATCTTCCAGTCCATGG + Intergenic
1069939239 10:71943058-71943080 AATTGGGATCATTTAATCCGGGG + Intergenic
1071058995 10:81548138-81548160 AAATGGGATCTTCTGATCCGCGG - Intergenic
1072402790 10:95122463-95122485 AAGTGGGGTCTTCTGAACTGTGG + Intergenic
1072759902 10:98047982-98048004 AAGTTGGATCTCCTGATTTGGGG + Intergenic
1072834503 10:98696550-98696572 AAATGGGATCTTCCAATCCATGG - Intronic
1074003278 10:109393485-109393507 AAGTGGGATCTTCGGATCTGTGG - Intergenic
1074480112 10:113811671-113811693 AAGTGGGCTCTTCTGATCTGTGG - Intergenic
1075172448 10:120128110-120128132 GAGTGGGATCTTCCGATCCGCGG + Intergenic
1075580220 10:123611896-123611918 AGTTGGGAGCTTCTGATCCCTGG - Intergenic
1075610677 10:123852359-123852381 AAGTAGGATTTTCTGATGCAGGG - Intronic
1075860909 10:125675536-125675558 GAGGGGGATCTCCTGATCCATGG + Intronic
1076185055 10:128440378-128440400 GAGTGGGATCTTCCAATCTGTGG - Intergenic
1078691165 11:13582270-13582292 GAGTGAGATCTTCTGAACTGTGG - Intergenic
1079425967 11:20342663-20342685 GAGTGGGATCTTCCGATCCGTGG - Intergenic
1079800211 11:24859836-24859858 AAGTGGGATCTTCCGATCCATGG - Intronic
1079935324 11:26609076-26609098 AAGTGGGATCTTCAAATCCATGG + Intronic
1080164950 11:29225073-29225095 AAGTGGGATCTTTTGATCTTTGG + Intergenic
1081269311 11:41064911-41064933 CAAGGGAATCTTCTGATCCGCGG - Intronic
1081340222 11:41918212-41918234 TAGTGGGATCTTCCAATCCATGG + Intergenic
1081455011 11:43212685-43212707 GAGTGGGATCTTCCGATCCGTGG + Intergenic
1082079250 11:47999518-47999540 AAGTGGGCTCTTCTCAACTGGGG + Intronic
1083226491 11:61288234-61288256 TAGTGAGATGTTCTGATCTGAGG + Intronic
1084575136 11:69984327-69984349 AAGTGGGATTTTATTCTCCGTGG - Intergenic
1085066232 11:73498406-73498428 TAGTGGGATCTTCTGATCCGTGG - Intronic
1085942603 11:81222827-81222849 GAGTGGGATCTTCTGATCTGTGG + Intergenic
1086301493 11:85431406-85431428 GAGTGGGATCTTCTGATCCATGG - Intronic
1086406284 11:86501849-86501871 AAGATGGATGATCTGATCCGAGG - Intronic
1086771749 11:90775303-90775325 GAGTGGGATCTTCTGATCTGTGG + Intergenic
1087317075 11:96615241-96615263 GAGTGGGATCTTCTGATCTGTGG + Intergenic
1088167693 11:106957437-106957459 GAGTGGGATCTTCCAATCCATGG + Intronic
1088504986 11:110518720-110518742 AAGTGGAATTTTGTGATCCCCGG + Intergenic
1088684544 11:112273911-112273933 AAGTGGGATCTCCTGATCTGTGG - Intergenic
1089027022 11:115281665-115281687 AAGATGGATCTTCAGATCCAGGG + Intronic
1093522430 12:20066774-20066796 TAGTGGGATCTTCTGATTCATGG - Intergenic
1093808382 12:23464258-23464280 AACTGGGATCTTCTGATCCATGG - Intergenic
1094054489 12:26255719-26255741 AAGTGGGATCTTCCAATCTGTGG - Intronic
1095320453 12:40819806-40819828 AAGTAGGATCTTCCGATCCGTGG + Intronic
1097421780 12:59389999-59390021 AAGTGGGATCTTCCGATCCATGG - Intergenic
1097455628 12:59795846-59795868 GAGTGGGATCTCCTAATCCATGG - Intergenic
1097643177 12:62205866-62205888 AAAGGGGATCTTCTGATTCATGG + Intronic
1097748883 12:63330608-63330630 GAGTGGGATCTTCCAATCTGTGG - Intergenic
1099684377 12:85866317-85866339 GAGTGGGATCTTCCAATCCATGG + Intergenic
1100028056 12:90153177-90153199 AAATGGGATTTTCTGATCTGTGG - Intergenic
1100049816 12:90434631-90434653 TTGTGGGATCTTGTGATCAGGGG + Intergenic
1100156266 12:91804121-91804143 CAAGGGGATCTCCTGATCCGTGG - Intergenic
1100742976 12:97615489-97615511 AAGTGGAATGTTCTGAGCCCTGG + Intergenic
1101066471 12:101027225-101027247 GAGTGGGATCTTCTAATCCGTGG - Intronic
1104256466 12:127143443-127143465 GACTGGGATCTTCCGATCCGTGG + Intergenic
1106890190 13:34236353-34236375 GAGTGGGATCTTTTGATCTGTGG + Intergenic
1108160330 13:47632335-47632357 GAGTGAGATCTTCTAATCTGTGG - Intergenic
1108815713 13:54287450-54287472 AAGTGGCATCTTCCGATCCGTGG + Intergenic
1108880444 13:55107742-55107764 GAGTGGGATCTTCCAATCCATGG - Intergenic
1109307992 13:60661854-60661876 AAGTGGGATCTTCTGATCCATGG + Intergenic
1110567215 13:76968421-76968443 GAGTGGGATCTTCCCATCCGTGG + Intergenic
1111092125 13:83461815-83461837 AAGTAGGATCTTCTGATCCGTGG - Intergenic
1111200270 13:84927499-84927521 GAGTGGGACCTTCCAATCCGTGG - Intergenic
1111305616 13:86409579-86409601 GAGTGGGATCTTCGAATCCGTGG - Intergenic
1115928905 14:38468110-38468132 AAGTGGGATCTTCCAATCCATGG + Intergenic
1117640964 14:57799291-57799313 ACGAGGGATCTCCTGATCCATGG - Intronic
1117703392 14:58438005-58438027 AAGTGTGATATGCTGCTCCGAGG + Intronic
1118523766 14:66617353-66617375 AAGTTGGATCTTCTGATCCATGG + Intronic
1118530613 14:66701657-66701679 GAGTGTGATCTTCTGATCCATGG - Intronic
1120247601 14:82025374-82025396 GAGTGGGATCTTCTGATCCATGG + Intergenic
1120365287 14:83561265-83561287 AAGTGGGATCTTCCTATCCATGG - Intergenic
1121706708 14:96001851-96001873 GAGTGGAAACTTCTGATCTGTGG - Intergenic
1122370335 14:101225902-101225924 AAGTGGGTGCTCCTGATCCAGGG + Intergenic
1122415620 14:101548269-101548291 AAGTGGGGTCTTCTGAGGCCAGG - Intergenic
1126064534 15:44816030-44816052 AAGTGGGATATTCTGATCTGTGG - Intergenic
1126284657 15:46996939-46996961 AAGTGGGATCTTCTGATCCGTGG + Intergenic
1126553057 15:49953821-49953843 AAGTGGGATCTTCTGATCAGTGG + Intronic
1127042320 15:54990809-54990831 GAGTGGGATCTTCCAATCTGTGG - Intergenic
1128255449 15:66192796-66192818 AGGTAGGATCTTCTGATTCCTGG + Intronic
1128856654 15:71023700-71023722 AAGGGGGATCTCCTGATCTGTGG - Intronic
1135103315 16:19625517-19625539 AAGTGGTATCATCTCATCTGTGG - Intronic
1136660044 16:31749589-31749611 GAATGGGATCTTCCGATCCGTGG + Intronic
1137074490 16:35944895-35944917 AAGAGGGAAGTTCTAATCCGTGG + Intergenic
1142409003 16:89906914-89906936 AAGTGGGAGCTTCTGACACGTGG + Intronic
1142911509 17:3097539-3097561 CAGTGGAATCTTCTGATTTGTGG - Intergenic
1148649555 17:49239811-49239833 ATGTGGGAGCTCCTGATCCTGGG - Intergenic
1149242232 17:54663629-54663651 GAGTGGGATCTTTGGATCCATGG + Intergenic
1150190558 17:63233356-63233378 GAGGGGGATCTCCTGATCTGTGG + Intronic
1150196582 17:63305215-63305237 GAGTAGGATCTTCCGATCCATGG + Intronic
1155514267 18:26608351-26608373 AGGTAGGATCTTGTGATCTGTGG + Intronic
1155762803 18:29588488-29588510 GAGTAGGATCTTCTGATGTGTGG - Intergenic
1156530064 18:37806377-37806399 GAGTGGGATCTTCCAATCCATGG + Intergenic
1156635064 18:39017815-39017837 AAGTGGGAACTGCTGGTCAGTGG + Intergenic
1156664513 18:39389778-39389800 AAGTGAGGTCTTCAGATCTGTGG - Intergenic
1156778411 18:40821651-40821673 CAGTGGGATCTTCCGATCTGTGG - Intergenic
1158105708 18:53882910-53882932 GAGTGGGATCTTCCAATCCATGG + Intergenic
1158729239 18:60004101-60004123 GAGTGGGATCTTCCGATCCACGG + Intergenic
1159189493 18:65023347-65023369 AAGTTGGATCCACTGATCCCTGG - Intergenic
1159956053 18:74519236-74519258 AAGTGGGAACTTCAGATGGGAGG + Intronic
1160556815 18:79730888-79730910 AATTTGGATCTTTTGAGCCGTGG + Intronic
1163872046 19:19830242-19830264 GAGTGGAATCTTCTGATCCATGG - Intergenic
1163886244 19:19967173-19967195 AAGTTGAATCTTCTAATCAGTGG + Intergenic
1163919635 19:20276461-20276483 AAGTGGAATCTTCTGAACTGTGG - Intergenic
1163949780 19:20572723-20572745 GAGTGGAATCTTCTAATCTGTGG + Intronic
1163958494 19:20665455-20665477 GAGCGGAATCTTCTGATCTGTGG + Intronic
1163968299 19:20769154-20769176 GAGTGGAATCTTCTAATCCGTGG - Intronic
1168457639 19:56526368-56526390 AAGGGGGATCTCCTGGTCTGTGG - Exonic
925433253 2:3815174-3815196 AAGTGGGATCTTCTGATCTGAGG + Intronic
925447567 2:3941000-3941022 AAGTGGGATCTTCTGATCCATGG + Intergenic
926873140 2:17445756-17445778 GAGTGGGATCTTCCAATCCATGG - Intergenic
928803626 2:35125209-35125231 GTGTGGGATCTTCTGATCCGTGG - Intergenic
929405496 2:41637115-41637137 GAGTGGGATCTTCTGATCTGTGG - Intergenic
930318663 2:49827698-49827720 GAGTGGGATCTTCCGATCCATGG + Intergenic
932013406 2:68000465-68000487 GAGTAGGATCTTCCAATCCGTGG - Intergenic
933237651 2:79882841-79882863 AAGTGGCGTCTTCCGATCCGTGG + Intronic
933602609 2:84348181-84348203 AAGTGGAATCTTCTGATCCATGG + Intergenic
933810102 2:86027767-86027789 CAGTGGGATCTTGGGATCTGAGG - Intronic
934622950 2:95826671-95826693 GAGTGGGATCTTCTGATCTGTGG + Intergenic
934810816 2:97275417-97275439 GAGTGGGATCTTCTGATCTGTGG - Intergenic
934826876 2:97432522-97432544 GAGTGGGATCTTCTGATCTGTGG + Intergenic
935745109 2:106183602-106183624 AAGTGGGAACTTCTCCTCTGAGG - Intronic
936750490 2:115635337-115635359 AAGGGGGATCTCCTGATCTATGG + Intronic
936849155 2:116874344-116874366 AAGTGGGATCTTCTGCTCTGTGG + Intergenic
937610484 2:123855599-123855621 GAGCGGGATCTTCTGATCTGTGG - Intergenic
937894040 2:126963746-126963768 GAGTGGGATCTTCCAATCCATGG + Intergenic
939109654 2:137992082-137992104 GAGTGGGATCTTCCAATCTGTGG - Intronic
939808889 2:146807866-146807888 GACTGGGATCTTCCGATCCGTGG - Intergenic
940094843 2:149962729-149962751 GAGTGGGATCTTCCAATCTGTGG + Intergenic
940865077 2:158809699-158809721 AAGTGATATCTTCTGTTCCCAGG + Intronic
941088621 2:161147457-161147479 TAGTGGGATCTTCTGACCTGTGG + Intronic
941694438 2:168535345-168535367 GAGTGGGATCTTCTGATCCATGG + Intronic
942924006 2:181411098-181411120 AAGTGGGATCTTCTGATCTGTGG - Intergenic
943216590 2:185044690-185044712 GAGTGAGATCTTTAGATCCGTGG + Intergenic
943250814 2:185519050-185519072 GAGTGGGATCTTCCGATCCATGG + Intergenic
943513986 2:188862280-188862302 GAGTGGAATCTTCTGATCCCTGG - Intergenic
945024384 2:205606253-205606275 GAGTGGGATCTCCTGATCCATGG + Intronic
947390284 2:229632119-229632141 AAGTGGTATCTTCTGTTCAATGG - Intronic
1168933595 20:1644697-1644719 GAGTGGGATCTCCCGATCTGAGG + Intronic
1169695840 20:8385655-8385677 GAGTGGGATCTTCCGATCCATGG + Intronic
1170496537 20:16930650-16930672 GAGTGGGATCTTCTGATACATGG - Intergenic
1173091382 20:39975258-39975280 GAGTGTGATCTTCTGATCCATGG + Intergenic
1175787418 20:61720690-61720712 CAGCGTGATTTTCTGATCCGTGG + Intronic
1176987737 21:15456489-15456511 TGATGGGATCTCCTGATCCGTGG + Intergenic
1177332950 21:19684576-19684598 AAGTGGGATTTTCTGAACTCTGG + Intergenic
1177956657 21:27606528-27606550 AAGTGGGATCTTCCGATCCGTGG + Intergenic
1182939001 22:34255575-34255597 AAGTGGGATCTTCCTATCTGTGG + Intergenic
949592663 3:5510327-5510349 AGATGGGATCTTCTGATCCATGG - Intergenic
951951365 3:28202712-28202734 AAGTGGGATCTTCTGATCCAGGG - Intergenic
952503860 3:33989589-33989611 GAGTGGGATCTTCTGATTCGTGG + Intergenic
952694522 3:36250032-36250054 AAGGGGGGTCTCCTGATCCATGG - Intergenic
953816744 3:46164030-46164052 GAGGGGGATCTCCTGATCTGAGG + Intronic
954486886 3:50861049-50861071 TAGTGGGATCTCCTGATCCGAGG + Intronic
954529333 3:51304608-51304630 AAGTAGGATCTCCTGATCTATGG + Intronic
957268931 3:78003566-78003588 GCGTGCGATCTTCTGATCAGTGG + Intergenic
957434193 3:80152402-80152424 AAGTGAGAACTTCTGATCCGTGG + Intergenic
957696883 3:83650299-83650321 GAGTGGGATCTCCTGATTTGTGG + Intergenic
958503807 3:94946989-94947011 GAGTGGGATCTTCTGATCTGTGG + Intergenic
958522293 3:95204952-95204974 AAGTGGGATCTTCCGATCCATGG + Intergenic
958656549 3:97009735-97009757 GAGTGGGATCTTTCGATCCATGG + Intronic
958759722 3:98292402-98292424 CAAGGGGATCTTCTGATCTGAGG + Intergenic
959031167 3:101300532-101300554 AAGTGAGATCTTCTGATCTGTGG + Intronic
959258692 3:104048169-104048191 GAGTGGGATCTTCCGATGCATGG - Intergenic
959452652 3:106522881-106522903 TAGTGGGATCTTCTGATCTGTGG - Intergenic
959694445 3:109234378-109234400 GAGTGGGATCTTCCGATCTGTGG - Intergenic
960016984 3:112902505-112902527 GAGTGGAATCTTCTGATCTGTGG + Intergenic
960413660 3:117358730-117358752 AAGTGGGATCTTCCGATCCATGG - Intergenic
960477325 3:118145267-118145289 GAGTGGGATCCTCCGATCCGTGG + Intergenic
960565268 3:119125896-119125918 GAGCGGGGTCTTCTGATCTGTGG - Intronic
962691850 3:137907257-137907279 GAGTGGGATCTTCCGATCCATGG - Intergenic
963531321 3:146476388-146476410 AAGTGGGATCTCATGATCCATGG - Intronic
964442675 3:156728304-156728326 AAGTGGGAGCTGCTGGTCCAGGG - Intergenic
964831141 3:160885715-160885737 GAGTGGGATCTTCCGATCCGTGG - Intronic
966539698 3:181075473-181075495 AAGTGGGATCTTCTGATCCGGGG + Intergenic
970154778 4:13130897-13130919 AAGTGGGATCTTCTGATCTGTGG - Intergenic
970952807 4:21776079-21776101 AAGTGGGATCTTCCAATCCATGG + Intronic
971286071 4:25291127-25291149 AAGAGGGACCTCCTGATCTGCGG + Intergenic
971853109 4:32010060-32010082 AAGTGGGATCTTCCGATCTTTGG - Intergenic
971906416 4:32732266-32732288 GAGTGGGATCTTCGGATCCATGG - Intergenic
973018780 4:45173097-45173119 GAGTGGCATCTTCCGATCTGTGG + Intergenic
974181287 4:58387057-58387079 GAGTGGAATTTTCTGATCTGTGG + Intergenic
974271407 4:59655951-59655973 GAGTGGGAGCTTCTGATCCATGG - Intergenic
974499626 4:62683835-62683857 AAGTGGGATCTTCTGATCTGTGG - Intergenic
974885160 4:67809391-67809413 GAGTAGGATCTTCCAATCCGTGG - Intergenic
974913370 4:68149483-68149505 AAGAGGGATCTCCTGATCTGCGG + Intergenic
975248032 4:72143032-72143054 AAGTGAGACCTTCTGATTCCTGG + Intronic
976046665 4:80956523-80956545 AAGTGGGATCATATGAGCCCAGG - Intronic
976538274 4:86242958-86242980 GAGTGGGATCTTCCGATCATTGG + Intronic
976769297 4:88634220-88634242 GAGTGGGATCTTCTGATCTGTGG - Intronic
977461953 4:97337083-97337105 AAGTGGGATCTTCCAATCCGTGG - Intronic
977509086 4:97938602-97938624 AAGTGGGATCTTCTGATCTGTGG + Intronic
978025491 4:103867985-103868007 GAGGGGGATCTCCTGATCCGAGG + Intergenic
978656753 4:111074558-111074580 GAGTGGGATCTTCCAATCCGTGG - Intergenic
978934590 4:114359452-114359474 AAGTGGGCTCTTAGGATCCTGGG - Intergenic
979197901 4:117941925-117941947 AAGAGGGATACTCTGATCCATGG + Intergenic
979732879 4:124045667-124045689 GAGGGGGATCTCCTGATCTGTGG + Intergenic
979775381 4:124583117-124583139 TAGTGGGATCTTCTGATCCATGG - Intergenic
980184584 4:129446106-129446128 AAGTGGGATCTTCCAACCCATGG - Intergenic
980489342 4:133505539-133505561 AAGTGGGATCTTCCAATCTGTGG - Intergenic
980744726 4:136999613-136999635 GAGTGGGATATTCTGATCTGTGG + Intergenic
980864780 4:138542208-138542230 CAGTGGGATCTTCCGATCTATGG - Intergenic
981186972 4:141815687-141815709 GAATGGGATCTTCTGATCCGTGG - Intergenic
981352754 4:143752042-143752064 GAGTGGGATCTTTTGATCCGTGG - Intergenic
982024102 4:151234838-151234860 AGGTGGGATCTCCTGAGCCCAGG - Intronic
982452874 4:155573173-155573195 GAGTGGGATCTGCCAATCCGTGG - Intergenic
982528153 4:156505600-156505622 AAGTGGGATCTTCTAATCCATGG - Intergenic
983726863 4:170940256-170940278 GAGTGGGATCTTCTGAACCGTGG - Intergenic
984092037 4:175387091-175387113 AAGTGGGATCTTCTGATCCACGG - Intergenic
984215693 4:176910669-176910691 GAGTGGGATCTTCTGGTCCACGG - Intergenic
984626190 4:182009844-182009866 GAGTAGGATCTTCCTATCCGTGG + Intergenic
986140586 5:5026241-5026263 GAGTAAGATCTTCTGATCCATGG - Intergenic
986492363 5:8306330-8306352 GCGTGGGATCTTTTGATCCATGG - Intergenic
987399905 5:17464124-17464146 AAATGGGATCTTCCGATCCATGG + Intergenic
987457201 5:18162583-18162605 AAGTGGAATCTTCCAATCCATGG + Intergenic
987834769 5:23146559-23146581 TAGCGGGATCTTCTGATCTGTGG + Intergenic
988059437 5:26148563-26148585 GAGTGGTATCTTCTGATCCGTGG - Intergenic
988076642 5:26362880-26362902 GAGTGGGATCTTCTGATCCATGG + Intergenic
988186517 5:27871071-27871093 AAGTGGGATCTTCTGATCTGTGG - Intergenic
989091976 5:37743290-37743312 AAGTGGGATCTTCTGATCCGTGG - Intronic
989348289 5:40454046-40454068 GAGTGGGATCTTCCAATCCATGG + Intergenic
989676755 5:43981866-43981888 GAGTGAGATCTTCCAATCCGTGG + Intergenic
990015986 5:51063582-51063604 AAGTGGGATTTTCCAATCCATGG - Intergenic
990139160 5:52682811-52682833 GAGTGGGATCTTCCGATCCATGG + Intergenic
990620181 5:57550549-57550571 GAATGGGATCTTCTGATCTGTGG + Intergenic
993117324 5:83734104-83734126 AAGTAGGATCTTCTGATCTGTGG + Intergenic
993450005 5:88061698-88061720 AAGTGGGAAATTCTGAACCGTGG - Intergenic
993511997 5:88782015-88782037 AAGGAGGATCTTTTGATCCCAGG + Intronic
993587391 5:89747344-89747366 GAGTTGGATCTTCTTATCTGTGG + Intergenic
995080597 5:108047306-108047328 GACTGGGATCTTCTGATCTGTGG - Intronic
995264262 5:110139381-110139403 GAGTGGGATCTTCTGATCTGTGG + Intergenic
995594283 5:113731345-113731367 TGGTGGGATCTTCCAATCCGTGG + Intergenic
995685420 5:114766723-114766745 AAGTGGGATCTTCCAATTCATGG + Intergenic
996527307 5:124492510-124492532 AAGTGGGATCTTCCAATCCGTGG + Intergenic
996638986 5:125730127-125730149 AAGTGGGATCTTCTGATCTGTGG - Intergenic
996893769 5:128455793-128455815 GAGTGGGATCCTCCGATTCGTGG - Intronic
997426448 5:133805948-133805970 AACTGGAACCTTCTGATCGGGGG - Intergenic
997636460 5:135410291-135410313 ATGTTGGGTCTTCTGATCCATGG + Intergenic
998277960 5:140776479-140776501 GAGTGGAATCTTCCGATCTGTGG + Intergenic
998788748 5:145743681-145743703 CAGTGGGATCTTCCGACCCACGG - Intronic
999026558 5:148239360-148239382 AAGTGGGAGCTTATGATTTGGGG - Intergenic
999596838 5:153214568-153214590 AAGTGGGAGCTTCCAATCCATGG - Intergenic
1001739180 5:174035651-174035673 AAGTGGGATCTTCTGATTTGGGG + Intergenic
1001839771 5:174865101-174865123 GAGTGGGATCTTCCGACCCGTGG + Intergenic
1002162768 5:177325877-177325899 AAGTGGGAAGTTGTGATCAGAGG - Intergenic
1003035376 6:2636870-2636892 AAGTGGGCCCTTCGGAACCGCGG - Intergenic
1003687162 6:8315464-8315486 GAGTGGGATCTTCCAATCTGTGG + Intergenic
1004760027 6:18656396-18656418 GAGTGGGATCTTCCAATCTGTGG - Intergenic
1004984004 6:21059442-21059464 CAGGGGGATCTACTGATCCATGG + Intronic
1005121114 6:22390087-22390109 AAGTGGGATCTTCCGATCCATGG + Intergenic
1006742085 6:36316185-36316207 AAGTGAGATCTTGTGACCCTTGG - Exonic
1008082563 6:47209674-47209696 CAAGGAGATCTTCTGATCCGAGG - Intergenic
1008244313 6:49151092-49151114 AAGTGGAATCTTCTGATCCATGG + Intergenic
1008468323 6:51855057-51855079 GAGTGGGATCTTCCGACCCATGG + Intronic
1008773726 6:55009517-55009539 GAGTGGGATCTTCCGATCCAAGG + Intergenic
1008819048 6:55609056-55609078 CAATGGGATCTTTCGATCCGTGG - Intergenic
1008834463 6:55808610-55808632 ACGTGGGATCTTCCAATCTGTGG + Intronic
1009316784 6:62229641-62229663 AAGTGGGATCTTCCAATTCGTGG + Intronic
1009707179 6:67266629-67266651 GAGGAGGATCTTCTGATCCATGG + Intergenic
1010283019 6:74041749-74041771 GAGTGGGATCTTCCAATCCGTGG + Intergenic
1010411622 6:75568162-75568184 GAGTGGGATCTTCTGATCCATGG - Intergenic
1010483278 6:76379592-76379614 AAGTGGGATCTTCCAGTCCATGG + Intergenic
1012741230 6:103018641-103018663 GAGTGGGATCTTCTGATCGTGGG + Intergenic
1014064643 6:117110770-117110792 GAGTGGGATCTTCCAATCCTTGG - Intergenic
1014422243 6:121260645-121260667 CAGTGGGATCTTCTGAACCATGG - Intronic
1014477377 6:121890100-121890122 CAGTGGGATCTTTTGAGCCCTGG + Intergenic
1014484826 6:121985354-121985376 AAGTGGGATCTTCCGATCCATGG + Intergenic
1015206291 6:130643450-130643472 AAGTGGAATTTGCTGATCAGAGG + Intergenic
1015512929 6:134057659-134057681 AGGAAGGATCTTCTGATCCTGGG - Intergenic
1016218624 6:141636291-141636313 AAGTGAGATTTGCTGATCCAAGG - Intergenic
1018054484 6:160040231-160040253 GAGTGGGATCCTCTGCTCCCGGG - Intronic
1019113594 6:169738428-169738450 AAGTGGAATCTTCTGATCTGTGG + Intergenic
1019140201 6:169937992-169938014 AAGTGGAAGCTTCTGAGCCTGGG + Intergenic
1019669664 7:2270665-2270687 CAGTGGGATCTTTTGAGCCCTGG - Intronic
1020633861 7:10672525-10672547 GAGTGGGATCTTCTGATCCATGG + Intergenic
1021186931 7:17575734-17575756 CAAGGGGATCTTCTGATCCATGG - Intergenic
1022155276 7:27654779-27654801 AAGTGGGATCATCTGAGCTTGGG - Intronic
1022634563 7:32119753-32119775 GAGTGGGATCTTCTGATCCATGG - Intronic
1023207116 7:37763275-37763297 GAGTGGGATCTTCTGATCTGTGG - Intronic
1027943980 7:84722649-84722671 AAGTGGCATCTTCTCATCCATGG - Intergenic
1028048840 7:86158143-86158165 AAGTGGGGTCTTCCGACCTGTGG - Intergenic
1028442454 7:90879961-90879983 AAGTGGGATCTTCCGATTGGTGG - Intronic
1028459105 7:91071528-91071550 GAGTGGGATCTTCCGATCCGTGG - Intronic
1030153546 7:106429162-106429184 ATGTGGGCTCTTCTAATCAGTGG + Intergenic
1030701642 7:112647221-112647243 AAGTGGGATCTTCCAATCCGTGG + Intergenic
1030759287 7:113331459-113331481 GAGTGGGATTTTCTGATCGTGGG - Intergenic
1031804516 7:126292364-126292386 GAGAGGGAACTTCCGATCCGTGG - Intergenic
1032245784 7:130210768-130210790 AAGTGGGATCATATGAACTGTGG - Intronic
1032919861 7:136533789-136533811 AAGTGGGATATTCTGATCCATGG - Intergenic
1033275415 7:139967820-139967842 AGGTGGGAACTTCTAATCTGGGG - Intronic
1033879342 7:145862257-145862279 GAGTGGGATCTTCCGATCCGTGG - Intergenic
1034445794 7:151113647-151113669 AACTGGTTTCTCCTGATCCGTGG + Intronic
1035491624 7:159284534-159284556 AAGTGGGATCTTCTGATTCATGG - Intergenic
1035599617 8:889897-889919 AAGTGGGATCTTCTGATCCGTGG + Intergenic
1037540844 8:19869306-19869328 TGGTGGGTTCTTTTGATCCGAGG - Intergenic
1038073630 8:24046081-24046103 GAGTGGGATCTTCTGATCCGTGG - Intergenic
1038243402 8:25831279-25831301 GAATGGGATCTTCTGATCCATGG + Intergenic
1038811167 8:30846222-30846244 ATGTGGTATGTTCTGATCCCTGG + Exonic
1039265078 8:35815598-35815620 GAGTGGGATCTTCTGATCCATGG - Intergenic
1039293909 8:36128042-36128064 AAGTGGGATCTTCCCATCCATGG + Intergenic
1039402169 8:37279248-37279270 GAGTGGGATCTTCTGATCCATGG - Intergenic
1039658173 8:39433260-39433282 AAGTGGGATTTTCCAATCCATGG - Intergenic
1040614258 8:49018681-49018703 CAGTTGGATCTTCTGATCCGTGG + Intergenic
1040763031 8:50874021-50874043 GAGTGGGATCTTCCAATCCATGG - Intergenic
1041021428 8:53642631-53642653 ACGTGGGATATTCTGATCCGTGG + Intergenic
1041211911 8:55560072-55560094 AAGTGGGATCTTTTAATCCGTGG + Intergenic
1044135901 8:88584921-88584943 AAGTGGGATATTCCGATCTGTGG + Intergenic
1044184592 8:89236472-89236494 AATTGGGATCATTTGATCTGGGG - Intergenic
1044356213 8:91225309-91225331 AAGTGGGATCTTCTGATCTGTGG + Intronic
1045247498 8:100456196-100456218 AAGTGTGTTCTTCAGATCTGGGG + Intergenic
1045705374 8:104916463-104916485 GAGTGGGATCTTCCGATCCGTGG + Intronic
1046330868 8:112713236-112713258 GAGTGGGATCTTCTGATCTGTGG - Intronic
1046702650 8:117418649-117418671 AAGGGGGATCTTCTGATCCAAGG - Intergenic
1048587782 8:135790973-135790995 GAGTGGGATCTTCCAATCCGTGG + Intergenic
1049182865 8:141231882-141231904 AAGTGGGGTCTCCTGATCTCGGG - Intronic
1050618343 9:7426558-7426580 GAGAGGGATCTTCTGATCCACGG + Intergenic
1050630029 9:7549257-7549279 GAGTGGGATCTTCTGATTCATGG - Intergenic
1050660674 9:7879884-7879906 GAGTGGGATCTTCCAATCCGTGG - Intronic
1052115760 9:24646750-24646772 GAGTGGGATCTTCCAATCCATGG + Intergenic
1052225353 9:26078264-26078286 CAATGGGATCTTCCAATCCGTGG + Intergenic
1052369169 9:27645174-27645196 AAGTGGGATCTTTCAATCCGTGG - Intergenic
1055818783 9:80237995-80238017 CTGTGGGATCTTCTGATCCATGG - Intergenic
1057241715 9:93417222-93417244 AAGGGGGATCTCCTGATCCATGG + Intergenic
1058374237 9:104304916-104304938 GAGTGGGATCTTCTGATCCGTGG - Intergenic
1059596228 9:115723852-115723874 GAGCGGGATCTTCCCATCCGTGG - Intergenic
1059895115 9:118855823-118855845 AAGTGGGATATTTCAATCCGGGG - Intergenic
1059999520 9:119945483-119945505 AATTTGGGTCTTCTGATCCCTGG - Intergenic
1060321180 9:122562459-122562481 AAGTGGGATCTTCTGATCTGTGG + Intergenic
1185846351 X:3441360-3441382 GAGTGGGATCTTCCGATCCATGG + Intergenic
1186050855 X:5593382-5593404 AAGGTGGTTCTTCTGAGCCGAGG - Intergenic
1186430864 X:9503300-9503322 GAGTGAGATCTTCCAATCCGTGG - Intronic
1188092087 X:25976768-25976790 AAGTGGGATCTTCCAATCCGTGG - Intergenic
1188669694 X:32868216-32868238 AAGTGGGATCTCCTGATCTGCGG - Intronic
1188884265 X:35531067-35531089 GAGTGGGATCTTCTGATCCGTGG - Intergenic
1189839067 X:45052783-45052805 AGGTGGGATCACCTGACCCGAGG - Intronic
1190529533 X:51361298-51361320 GAGTGGGATATTCCGATCCATGG - Intergenic
1191225266 X:58035590-58035612 GAGTGGAATCTTCTGATCTGTGG + Intergenic
1191701477 X:64047357-64047379 ATGAGGGATCTCCTGATCCATGG - Intergenic
1192716378 X:73647176-73647198 AAGTGGGATCTTCCAATACGTGG - Intronic
1192951875 X:76026131-76026153 GAGTGGGATCTTCTGATCTGTGG - Intergenic
1193039235 X:76987356-76987378 GAGTGGGTTCTTATGATCCATGG - Intergenic
1193091027 X:77494170-77494192 GAATGGGATCTTCTGATCCATGG - Intergenic
1193227198 X:78998218-78998240 AAGTAGGATCTTTTGATCCATGG - Intergenic
1193533691 X:82686884-82686906 AAGGGGGATCTCCTGATCTCTGG + Intergenic
1193595478 X:83439613-83439635 AAGTGGGATCTCCTTATCTGTGG + Intergenic
1193719585 X:84971791-84971813 GAGTGGGATCTTCCGATCCATGG + Intergenic
1193768601 X:85561557-85561579 TAGTGGGATCTTCCGATCCATGG + Intergenic
1193780852 X:85699314-85699336 AAGTGGGATCATCCGGTCCATGG + Intergenic
1194058268 X:89164112-89164134 GAGTGGGATCTTCTAATCTGTGG + Intergenic
1194264075 X:91734000-91734022 GAGGGGGATCTTCTGATCTGTGG + Intergenic
1194489614 X:94530406-94530428 GAGTGGGATCTCCTGATCCATGG - Intergenic
1194523079 X:94942597-94942619 AAGTGAGATCTTCTGATCCGTGG - Intergenic
1194851896 X:98880828-98880850 CAGTGACATCTTCTGATCTGTGG - Intergenic
1195147114 X:102029036-102029058 GAGTGAGATCTTCTGATCCATGG - Intergenic
1195979425 X:110561549-110561571 GAGTGGGATCTTCTGATCTGTGG + Intergenic
1195983056 X:110600765-110600787 GAGTGGGATCTTCGGTTCCGTGG - Intergenic
1196229355 X:113203084-113203106 GAGGGGGATCTTCTTATCTGTGG + Intergenic
1196517337 X:116628902-116628924 AAGTGGGAACTTCTGATTCGTGG + Intergenic
1196555940 X:117084305-117084327 GAGTGGGATCTTCTGAACTGTGG + Intergenic
1196607425 X:117672117-117672139 AAGTGGGATTTTCCCATCCATGG + Intergenic
1197046544 X:122004465-122004487 GAGTGGGATCTTCCAATCCATGG + Intergenic
1197049628 X:122042796-122042818 GAGTGGGATCTTCTGATCCATGG + Intergenic
1197124207 X:122925083-122925105 GAGTGGAATCTTCTGATCCATGG + Intergenic
1197403990 X:126027844-126027866 AAGTGGGATCTTCCAATCTGTGG + Intergenic
1197607174 X:128597809-128597831 AAGTGGGATCTTGCGATCTATGG + Intergenic
1199567447 X:149230344-149230366 GAGTGGGATCTTCCGATCTGTGG + Intergenic
1200818151 Y:7555012-7555034 GAGTGGGATCTTCCGATCCATGG - Intergenic
1202075338 Y:21031840-21031862 AAGTGGGACCTTTTGATCCATGG + Intergenic
1202092469 Y:21208543-21208565 GGATGGGATCTTCTGATCTGTGG - Intergenic