ID: 1035599618

View in Genome Browser
Species Human (GRCh38)
Location 8:889898-889920
Sequence AGTGGGATCTTCTGATCCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 465
Summary {0: 8, 1: 59, 2: 94, 3: 114, 4: 190}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035599614_1035599618 -4 Left 1035599614 8:889879-889901 CCAGTGGCGTGAGTTTGCAAGTG No data
Right 1035599618 8:889898-889920 AGTGGGATCTTCTGATCCGTGGG 0: 8
1: 59
2: 94
3: 114
4: 190
1035599610_1035599618 17 Left 1035599610 8:889858-889880 CCGGGGCTGGAACTGTAGGCCCC No data
Right 1035599618 8:889898-889920 AGTGGGATCTTCTGATCCGTGGG 0: 8
1: 59
2: 94
3: 114
4: 190
1035599612_1035599618 -2 Left 1035599612 8:889877-889899 CCCCAGTGGCGTGAGTTTGCAAG No data
Right 1035599618 8:889898-889920 AGTGGGATCTTCTGATCCGTGGG 0: 8
1: 59
2: 94
3: 114
4: 190
1035599613_1035599618 -3 Left 1035599613 8:889878-889900 CCCAGTGGCGTGAGTTTGCAAGT No data
Right 1035599618 8:889898-889920 AGTGGGATCTTCTGATCCGTGGG 0: 8
1: 59
2: 94
3: 114
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035599618 Original CRISPR AGTGGGATCTTCTGATCCGT GGG Intergenic
902547608 1:17199732-17199754 TGTGGGCTCTTCTGGTCCGGGGG - Intergenic
907607968 1:55838597-55838619 AGTAGTTTCTTCTGATCAGTGGG + Intergenic
908910994 1:69072202-69072224 AGTGGGATCTTCTGATCTGTAGG + Intergenic
909303022 1:74037852-74037874 AGTGGGATCCTCCAATCCTTGGG - Intronic
910518405 1:88088842-88088864 AGTGGGATCTTCCGATCTGTGGG + Intergenic
910619426 1:89236441-89236463 AGTGGGATCTCCTGATACGTGGG + Intergenic
911228943 1:95339434-95339456 AGTTGGATCATCTGATCTTTCGG - Intergenic
911242710 1:95483167-95483189 AGTGGGATCTTCTGATCTGTGGG - Intergenic
911464288 1:98232884-98232906 AAGGGGATCTTCTGATCTGCAGG - Intergenic
911508479 1:98783834-98783856 AGTGGGATCTTTCAATCCATGGG - Intergenic
913541239 1:119822743-119822765 AGAGGGATCTTCCAATCTGTGGG + Intergenic
914404524 1:147357889-147357911 AATGGGATCTTCCAATCCATGGG - Intergenic
915970229 1:160349680-160349702 AGTAGGCTCTCCTGATCCTTTGG - Intronic
916916824 1:169416128-169416150 AGTGGGATCTTCTGATCCATGGG + Intronic
916986071 1:170192273-170192295 AGGGGGATCTCCTGATCTGCAGG + Intergenic
917024938 1:170631481-170631503 AGTGGGATCTTCCGATCCGTGGG + Intergenic
917060640 1:171033402-171033424 AATGGGATCTTCCAATCCGTGGG + Intronic
917062479 1:171056001-171056023 AGTGGGATCTTTCAATCTGTGGG - Intronic
917269586 1:173258475-173258497 AAGGGGATCTCCTGATCCGCAGG - Intergenic
917356517 1:174131593-174131615 AGTGGGATCTTCTGATCTGTGGG + Intergenic
918156167 1:181849110-181849132 AGTGGGGTCTTCCAATCCATGGG - Intergenic
918168663 1:181974840-181974862 AGTGGGATCTTCTGATCCGTGGG - Intergenic
918697390 1:187560796-187560818 AATGTGATCTTCTGATCCGTGGG + Intergenic
918887089 1:190208338-190208360 AGTGGCATGTTCTGATCCAGAGG - Intronic
918943097 1:191026885-191026907 AGTGGGATCTTCTGATGCACGGG - Intergenic
919231374 1:194779276-194779298 AGGGGGATCTCCTGATCTGCGGG - Intergenic
921097166 1:211896523-211896545 AGTGGGCTCTTCAGATCTGTGGG + Intergenic
922399701 1:225239325-225239347 CGGGGGATCTCCTGATCTGTGGG + Intronic
922693546 1:227713624-227713646 AGTGGGATCTTCCGATCCGTGGG - Intergenic
923907065 1:238396627-238396649 ATTGAGATTTTCTGATCTGTGGG - Intergenic
924779182 1:247131306-247131328 AGTGGGATCTTCCAATCCGTGGG - Intronic
1066525531 10:36274959-36274981 AGTGGGATCTCCTGATCTTTGGG - Intergenic
1068126946 10:52851744-52851766 AGTGGGATCTTCCAGTCCATGGG + Intergenic
1069370877 10:67746686-67746708 AGTGGGATCTCCTGATCTGCAGG - Intergenic
1071071238 10:81696929-81696951 AGTGGGATCTCCCAATCCATGGG - Intergenic
1071134644 10:82438674-82438696 AGTGGGATCTTCCCTTCCATGGG + Intronic
1071493352 10:86151770-86151792 AATGGGACCTCCTGATCCCTGGG + Intronic
1072394740 10:95026920-95026942 AATGGAATCTTCTGGTCTGTGGG + Intergenic
1072402791 10:95122464-95122486 AGTGGGGTCTTCTGAACTGTGGG + Intergenic
1072834502 10:98696549-98696571 AATGGGATCTTCCAATCCATGGG - Intronic
1074003277 10:109393484-109393506 AGTGGGATCTTCGGATCTGTGGG - Intergenic
1074480111 10:113811670-113811692 AGTGGGCTCTTCTGATCTGTGGG - Intergenic
1075172449 10:120128111-120128133 AGTGGGATCTTCCGATCCGCGGG + Intergenic
1075860910 10:125675537-125675559 AGGGGGATCTCCTGATCCATGGG + Intronic
1076185054 10:128440377-128440399 AGTGGGATCTTCCAATCTGTGGG - Intergenic
1076388010 10:130073136-130073158 AGTGTGATCTTATCCTCCGTGGG + Intergenic
1077377863 11:2213796-2213818 AGTGCGATCTTCTCATACGGTGG - Intergenic
1078691164 11:13582269-13582291 AGTGAGATCTTCTGAACTGTGGG - Intergenic
1079425966 11:20342662-20342684 AGTGGGATCTTCCGATCCGTGGG - Intergenic
1079654806 11:22974387-22974409 AAGGGGATCTTCTGATATGTGGG + Intergenic
1079800210 11:24859835-24859857 AGTGGGATCTTCCGATCCATGGG - Intronic
1079935325 11:26609077-26609099 AGTGGGATCTTCAAATCCATGGG + Intronic
1079966266 11:26983944-26983966 AGTGGAATCTTCCAATCTGTGGG + Intergenic
1080130957 11:28793428-28793450 AGTGGGACTTTCCGATCTGTGGG + Intergenic
1080164951 11:29225074-29225096 AGTGGGATCTTTTGATCTTTGGG + Intergenic
1081340223 11:41918213-41918235 AGTGGGATCTTCCAATCCATGGG + Intergenic
1081455012 11:43212686-43212708 AGTGGGATCTTCCGATCCGTGGG + Intergenic
1083226492 11:61288235-61288257 AGTGAGATGTTCTGATCTGAGGG + Intronic
1083521787 11:63320416-63320438 AGTGGAATCTTCCAATCCATGGG - Intronic
1084575135 11:69984326-69984348 AGTGGGATTTTATTCTCCGTGGG - Intergenic
1085066231 11:73498405-73498427 AGTGGGATCTTCTGATCCGTGGG - Intronic
1085942604 11:81222828-81222850 AGTGGGATCTTCTGATCTGTGGG + Intergenic
1086301492 11:85431405-85431427 AGTGGGATCTTCTGATCCATGGG - Intronic
1087317076 11:96615242-96615264 AGTGGGATCTTCTGATCTGTGGG + Intergenic
1087328735 11:96753799-96753821 AAGGGGATCTCCTGATCTGTGGG + Intergenic
1088084527 11:105960766-105960788 AGTGGGACCTTCCCATCTGTGGG + Intronic
1088167694 11:106957438-106957460 AGTGGGATCTTCCAATCCATGGG + Intronic
1088684543 11:112273910-112273932 AGTGGGATCTCCTGATCTGTGGG - Intergenic
1089779448 11:120862750-120862772 AGTTGGATGTTCTTCTCCGTGGG + Intronic
1090734343 11:129598353-129598375 AGTGAGATCTTCCGATTTGTGGG - Intergenic
1093303231 12:17479159-17479181 AGTGGGATGTTCCCATCCCTGGG - Intergenic
1093522429 12:20066773-20066795 AGTGGGATCTTCTGATTCATGGG - Intergenic
1094054488 12:26255718-26255740 AGTGGGATCTTCCAATCTGTGGG - Intronic
1094275266 12:28668419-28668441 AGTGGGATCTTCCAATCCGCAGG - Intergenic
1094329235 12:29273788-29273810 AGTGGGCTCTTCTGACCCATAGG + Intronic
1095320454 12:40819807-40819829 AGTAGGATCTTCCGATCCGTGGG + Intronic
1097232140 12:57519518-57519540 AGTGGCAGCTGCTGATCCCTAGG + Intronic
1097455627 12:59795845-59795867 AGTGGGATCTCCTAATCCATGGG - Intergenic
1097529548 12:60781019-60781041 AGTGGGAGCTTCCAATCCATGGG + Intergenic
1097643178 12:62205867-62205889 AAGGGGATCTTCTGATTCATGGG + Intronic
1097748882 12:63330607-63330629 AGTGGGATCTTCCAATCTGTGGG - Intergenic
1098694627 12:73537482-73537504 AGTGGGTTCTTCCAATCCATGGG - Intergenic
1100115029 12:91294142-91294164 AGGGAGATCTCCTGATCCATGGG - Intergenic
1100742977 12:97615490-97615512 AGTGGAATGTTCTGAGCCCTGGG + Intergenic
1100941022 12:99723015-99723037 AGTGAGATCTTCTGATCAGGAGG - Intronic
1101066470 12:101027224-101027246 AGTGGGATCTTCTAATCCGTGGG - Intronic
1104256467 12:127143444-127143466 ACTGGGATCTTCCGATCCGTGGG + Intergenic
1106890191 13:34236354-34236376 AGTGGGATCTTTTGATCTGTGGG + Intergenic
1108815714 13:54287451-54287473 AGTGGCATCTTCCGATCCGTGGG + Intergenic
1108880443 13:55107741-55107763 AGTGGGATCTTCCAATCCATGGG - Intergenic
1109307993 13:60661855-60661877 AGTGGGATCTTCTGATCCATGGG + Intergenic
1110567216 13:76968422-76968444 AGTGGGATCTTCCCATCCGTGGG + Intergenic
1110836954 13:80093997-80094019 AGTGGGATCTTCTGATCTGTTGG + Intergenic
1111045163 13:82805291-82805313 AGTGGCTTCTTTTGATCCATGGG - Intergenic
1111092124 13:83461814-83461836 AGTAGGATCTTCTGATCCGTGGG - Intergenic
1111200269 13:84927498-84927520 AGTGGGACCTTCCAATCCGTGGG - Intergenic
1111305615 13:86409578-86409600 AGTGGGATCTTCGAATCCGTGGG - Intergenic
1113951875 13:114076467-114076489 TGTGGGATCTTCACATCGGTGGG - Intronic
1113969650 13:114179127-114179149 AGTGGGATCTTCTTCTCCACTGG - Intergenic
1114705893 14:24726534-24726556 AGTGGGATCTTCCAATCTGTAGG - Intergenic
1115928906 14:38468111-38468133 AGTGGGATCTTCCAATCCATGGG + Intergenic
1115936918 14:38562118-38562140 AGTGTCATCTACTGATCTGTAGG + Intergenic
1116685758 14:48036172-48036194 AGTGGGATATTCCGAACCATGGG + Intergenic
1117640963 14:57799290-57799312 CGAGGGATCTCCTGATCCATGGG - Intronic
1117750979 14:58923871-58923893 AAGGGGATCTCCTGATCTGTGGG - Intergenic
1118478828 14:66143672-66143694 AGTGGGATCTTCCAATCTATGGG - Intergenic
1118523767 14:66617354-66617376 AGTTGGATCTTCTGATCCATGGG + Intronic
1118530612 14:66701656-66701678 AGTGTGATCTTCTGATCCATGGG - Intronic
1118558320 14:67050967-67050989 AGGGGAATCTCCTGATCTGTGGG - Intronic
1120247602 14:82025375-82025397 AGTGGGATCTTCTGATCCATGGG + Intergenic
1120365286 14:83561264-83561286 AGTGGGATCTTCCTATCCATGGG - Intergenic
1121142359 14:91554794-91554816 AAGGGGATCTCCTGATCTGTGGG - Intergenic
1121706707 14:96001850-96001872 AGTGGAAACTTCTGATCTGTGGG - Intergenic
1121905759 14:97741398-97741420 AGTGAGAACTTCTGACCTGTGGG + Intergenic
1126064533 15:44816029-44816051 AGTGGGATATTCTGATCTGTGGG - Intergenic
1126284658 15:46996940-46996962 AGTGGGATCTTCTGATCCGTGGG + Intergenic
1126553058 15:49953822-49953844 AGTGGGATCTTCTGATCAGTGGG + Intronic
1126640555 15:50820877-50820899 AGTTGCATCTGCTGGTCCGTAGG - Intergenic
1127042319 15:54990808-54990830 AGTGGGATCTTCCAATCTGTGGG - Intergenic
1127663827 15:61124799-61124821 AGTGTGATCTTCTTATCAGATGG - Intronic
1128856653 15:71023699-71023721 AGGGGGATCTCCTGATCTGTGGG - Intronic
1131432412 15:92397103-92397125 AGTGGGACCCTGTGATCTGTTGG + Intronic
1135103314 16:19625516-19625538 AGTGGTATCATCTCATCTGTGGG - Intronic
1136643570 16:31589089-31589111 AGAGGGATCTCTTGATCTGTAGG + Intergenic
1136660045 16:31749590-31749612 AATGGGATCTTCCGATCCGTGGG + Intronic
1136662038 16:31771721-31771743 AGGGGGATCTTTTGATCTGTAGG - Intronic
1139169766 16:64615975-64615997 AGTAGGATCTTCCAATCCATGGG + Intergenic
1139848550 16:69937005-69937027 AGTGGGCTCTGCTGATCTGGTGG + Intronic
1142911508 17:3097538-3097560 AGTGGAATCTTCTGATTTGTGGG - Intergenic
1142916430 17:3142886-3142908 AAGGGGATCTCCTGATCTGTGGG + Intergenic
1144150365 17:12437209-12437231 AGTGGTTTCTTCTGATCCTCAGG + Intergenic
1149229764 17:54519275-54519297 AGCGGGATCTTCCGATCCATTGG + Intergenic
1149242233 17:54663630-54663652 AGTGGGATCTTTGGATCCATGGG + Intergenic
1149378014 17:56064863-56064885 AATGGGATCTTCCAATCTGTGGG + Intergenic
1150190559 17:63233357-63233379 AGGGGGATCTCCTGATCTGTGGG + Intronic
1150196583 17:63305216-63305238 AGTAGGATCTTCCGATCCATGGG + Intronic
1152774684 17:82193653-82193675 AGTGGGACCCTCTGCTCCCTGGG + Intronic
1156664512 18:39389777-39389799 AGTGAGGTCTTCAGATCTGTGGG - Intergenic
1156778410 18:40821650-40821672 AGTGGGATCTTCCGATCTGTGGG - Intergenic
1157164561 18:45346575-45346597 AGTGGCATCTTCTGATAAGCAGG + Intronic
1158105709 18:53882911-53882933 AGTGGGATCTTCCAATCCATGGG + Intergenic
1158729240 18:60004102-60004124 AGTGGGATCTTCCGATCCACGGG + Intergenic
1163872045 19:19830241-19830263 AGTGGAATCTTCTGATCCATGGG - Intergenic
1163886245 19:19967174-19967196 AGTTGAATCTTCTAATCAGTGGG + Intergenic
1163919634 19:20276460-20276482 AGTGGAATCTTCTGAACTGTGGG - Intergenic
1163949781 19:20572724-20572746 AGTGGAATCTTCTAATCTGTGGG + Intronic
1163968298 19:20769153-20769175 AGTGGAATCTTCTAATCCGTGGG - Intronic
1168457638 19:56526367-56526389 AGGGGGATCTCCTGGTCTGTGGG - Exonic
925433254 2:3815175-3815197 AGTGGGATCTTCTGATCTGAGGG + Intronic
925447568 2:3941001-3941023 AGTGGGATCTTCTGATCCATGGG + Intergenic
926873139 2:17445755-17445777 AGTGGGATCTTCCAATCCATGGG - Intergenic
928757644 2:34545801-34545823 AGCGGGATCTTCCGATCTGTAGG + Intergenic
928803625 2:35125208-35125230 TGTGGGATCTTCTGATCCGTGGG - Intergenic
928849969 2:35734125-35734147 AAAGGGATCCCCTGATCCGTGGG - Intergenic
928883529 2:36123166-36123188 AAGGGGATCTCCTGATCCATGGG + Intergenic
929370851 2:41222639-41222661 AGTGGGATCTTTAGATCTATGGG - Intergenic
929405495 2:41637114-41637136 AGTGGGATCTTCTGATCTGTGGG - Intergenic
930318664 2:49827699-49827721 AGTGGGATCTTCCGATCCATGGG + Intergenic
930552497 2:52852786-52852808 TGTGGGATCTTCGGATCCGTAGG + Intergenic
932013405 2:68000464-68000486 AGTAGGATCTTCCAATCCGTGGG - Intergenic
932826660 2:74947721-74947743 AGTGGGATCTTCCGATCCATAGG - Intergenic
933129417 2:78654826-78654848 AGGGGGATCTTCCTATCTGTGGG - Intergenic
933237652 2:79882842-79882864 AGTGGCGTCTTCCGATCCGTGGG + Intronic
933602610 2:84348182-84348204 AGTGGAATCTTCTGATCCATGGG + Intergenic
933810101 2:86027766-86027788 AGTGGGATCTTGGGATCTGAGGG - Intronic
936750491 2:115635338-115635360 AGGGGGATCTCCTGATCTATGGG + Intronic
936849156 2:116874345-116874367 AGTGGGATCTTCTGCTCTGTGGG + Intergenic
937610483 2:123855598-123855620 AGCGGGATCTTCTGATCTGTGGG - Intergenic
937931436 2:127208372-127208394 AGTGGGATCTTCTGACCTGTAGG - Intronic
939109653 2:137992081-137992103 AGTGGGATCTTCCAATCTGTGGG - Intronic
939180232 2:138795184-138795206 AGTGGGATCTCCTGATTCACAGG + Intergenic
939192346 2:138931537-138931559 AGCAGGATCTTCTGATCCGTTGG - Intergenic
939759266 2:146154125-146154147 ACTTGGATATTCTGATCCCTGGG - Intergenic
939808888 2:146807865-146807887 ACTGGGATCTTCCGATCCGTGGG - Intergenic
940094844 2:149962730-149962752 AGTGGGATCTTCCAATCTGTGGG + Intergenic
940167605 2:150792718-150792740 AATGGGATCTTCCAATCCATGGG - Intergenic
940410673 2:153360281-153360303 AGTGGGATCTTCCAGTCTGTCGG - Intergenic
940615816 2:156047670-156047692 AGTGGGATCTTCCGATCCATTGG - Intergenic
941088622 2:161147458-161147480 AGTGGGATCTTCTGACCTGTGGG + Intronic
941444678 2:165585997-165586019 CCTGGGTTCATCTGATCCGTAGG - Intronic
941694439 2:168535346-168535368 AGTGGGATCTTCTGATCCATGGG + Intronic
942376167 2:175339933-175339955 AGTGGAATCTTCCAATCCATGGG + Intergenic
942924005 2:181411097-181411119 AGTGGGATCTTCTGATCTGTGGG - Intergenic
943216591 2:185044691-185044713 AGTGAGATCTTTAGATCCGTGGG + Intergenic
943250815 2:185519051-185519073 AGTGGGATCTTCCGATCCATGGG + Intergenic
943513985 2:188862279-188862301 AGTGGAATCTTCTGATCCCTGGG - Intergenic
945024385 2:205606254-205606276 AGTGGGATCTCCTGATCCATGGG + Intronic
945439823 2:209864983-209865005 AGGGGCATCTTCGGATCTGTGGG + Intronic
947486413 2:230553810-230553832 AGTTCTCTCTTCTGATCCGTTGG - Intergenic
1168933596 20:1644698-1644720 AGTGGGATCTCCCGATCTGAGGG + Intronic
1169695841 20:8385656-8385678 AGTGGGATCTTCCGATCCATGGG + Intronic
1170496536 20:16930649-16930671 AGTGGGATCTTCTGATACATGGG - Intergenic
1173285512 20:41668090-41668112 AGTGGAATATTCTGTTCCTTAGG - Intergenic
1176987738 21:15456490-15456512 GATGGGATCTCCTGATCCGTGGG + Intergenic
1177332951 21:19684577-19684599 AGTGGGATTTTCTGAACTCTGGG + Intergenic
1177956658 21:27606529-27606551 AGTGGGATCTTCCGATCCGTGGG + Intergenic
1182939002 22:34255576-34255598 AGTGGGATCTTCCTATCTGTGGG + Intergenic
1184480740 22:44745448-44745470 AATGGGATCATCTGTGCCGTGGG - Intronic
949120012 3:373751-373773 AGTGGGGTCTTCCAATCCATGGG + Intronic
949592662 3:5510326-5510348 GATGGGATCTTCTGATCCATGGG - Intergenic
950195939 3:11009286-11009308 AGTGGGATGTTGTGAACAGTAGG + Intronic
951951364 3:28202711-28202733 AGTGGGATCTTCTGATCCAGGGG - Intergenic
952503861 3:33989590-33989612 AGTGGGATCTTCTGATTCGTGGG + Intergenic
952694521 3:36250031-36250053 AGGGGGGTCTCCTGATCCATGGG - Intergenic
953269178 3:41423867-41423889 AGGGGGATCTCTTGATCTGTGGG - Intronic
953816745 3:46164031-46164053 AGGGGGATCTCCTGATCTGAGGG + Intronic
954486887 3:50861050-50861072 AGTGGGATCTCCTGATCCGAGGG + Intronic
954529334 3:51304609-51304631 AGTAGGATCTCCTGATCTATGGG + Intronic
957291271 3:78281299-78281321 AGTGGCATCTTCCGATACATGGG - Intergenic
957434194 3:80152403-80152425 AGTGAGAACTTCTGATCCGTGGG + Intergenic
957696884 3:83650300-83650322 AGTGGGATCTCCTGATTTGTGGG + Intergenic
958481995 3:94654485-94654507 AGTGGGATCTCCCGATTCTTGGG + Intergenic
958503808 3:94946990-94947012 AGTGGGATCTTCTGATCTGTGGG + Intergenic
958656550 3:97009736-97009758 AGTGGGATCTTTCGATCCATGGG + Intronic
958759723 3:98292403-98292425 AAGGGGATCTTCTGATCTGAGGG + Intergenic
958889451 3:99767164-99767186 AGTGTCACCTTCTGAGCCGTAGG - Intronic
959031168 3:101300533-101300555 AGTGAGATCTTCTGATCTGTGGG + Intronic
959205717 3:103304033-103304055 AGTGGGATATTCCTATCTGTGGG + Intergenic
959258691 3:104048168-104048190 AGTGGGATCTTCCGATGCATGGG - Intergenic
959418439 3:106104678-106104700 AATGGGATCTTCTGGTTCATGGG + Intergenic
959452651 3:106522880-106522902 AGTGGGATCTTCTGATCTGTGGG - Intergenic
959694444 3:109234377-109234399 AGTGGGATCTTCCGATCTGTGGG - Intergenic
960016985 3:112902506-112902528 AGTGGAATCTTCTGATCTGTGGG + Intergenic
960413659 3:117358729-117358751 AGTGGGATCTTCCGATCCATGGG - Intergenic
960477326 3:118145268-118145290 AGTGGGATCCTCCGATCCGTGGG + Intergenic
960565267 3:119125895-119125917 AGCGGGGTCTTCTGATCTGTGGG - Intronic
962691849 3:137907256-137907278 AGTGGGATCTTCCGATCCATGGG - Intergenic
963093278 3:141507257-141507279 AGTGGGATTTTCTAATTTGTTGG + Intronic
963461314 3:145617623-145617645 AGTGGGATCTTCCAATCTATGGG + Intergenic
963531320 3:146476387-146476409 AGTGGGATCTCATGATCCATGGG - Intronic
964007834 3:151852401-151852423 AATTGGATCTTCTGATCCACAGG + Intergenic
965288857 3:166850001-166850023 AAAGGGATCTTCTTATCCATGGG + Intergenic
966454699 3:180102020-180102042 AAGGGGATGTCCTGATCCGTGGG - Intergenic
966539699 3:181075474-181075496 AGTGGGATCTTCTGATCCGGGGG + Intergenic
967216882 3:187218729-187218751 ACTTGGAGCTTCTGATCCCTTGG + Intronic
969651408 4:8470292-8470314 AGTGTGGTGTCCTGATCCGTAGG + Intronic
970154777 4:13130896-13130918 AGTGGGATCTTCTGATCTGTGGG - Intergenic
970494213 4:16609219-16609241 AGTGGGATCTTCTGATCTGTAGG - Intronic
970952808 4:21776080-21776102 AGTGGGATCTTCCAATCCATGGG + Intronic
971853108 4:32010059-32010081 AGTGGGATCTTCCGATCTTTGGG - Intergenic
971906415 4:32732265-32732287 AGTGGGATCTTCGGATCCATGGG - Intergenic
972021929 4:34326511-34326533 AAGGGGATCTCCTGATCCATAGG - Intergenic
974271406 4:59655950-59655972 AGTGGGAGCTTCTGATCCATGGG - Intergenic
974499625 4:62683834-62683856 AGTGGGATCTTCTGATCTGTGGG - Intergenic
974739244 4:65983199-65983221 AGTGCAATCTTCTAATCCGTTGG - Intergenic
974760292 4:66266065-66266087 AGTAGAATCTTCCAATCCGTGGG - Intergenic
974885159 4:67809390-67809412 AGTAGGATCTTCCAATCCGTGGG - Intergenic
974913371 4:68149484-68149506 AGAGGGATCTCCTGATCTGCGGG + Intergenic
975416152 4:74106827-74106849 AGTGAGATCTTCTGAAGCTTAGG - Intergenic
976538275 4:86242959-86242981 AGTGGGATCTTCCGATCATTGGG + Intronic
976769296 4:88634219-88634241 AGTGGGATCTTCTGATCTGTGGG - Intronic
977461952 4:97337082-97337104 AGTGGGATCTTCCAATCCGTGGG - Intronic
977509087 4:97938603-97938625 AGTGGGATCTTCTGATCTGTGGG + Intronic
978025492 4:103867986-103868008 AGGGGGATCTCCTGATCCGAGGG + Intergenic
978656752 4:111074557-111074579 AGTGGGATCTTCCAATCCGTGGG - Intergenic
979197902 4:117941926-117941948 AGAGGGATACTCTGATCCATGGG + Intergenic
979732880 4:124045668-124045690 AGGGGGATCTCCTGATCTGTGGG + Intergenic
979775380 4:124583116-124583138 AGTGGGATCTTCTGATCCATGGG - Intergenic
979978412 4:127224937-127224959 AGTGGGACCTTCCAATCCATCGG + Intergenic
980184583 4:129446105-129446127 AGTGGGATCTTCCAACCCATGGG - Intergenic
980392996 4:132170009-132170031 AGTGGCATCTTCCAATCCATGGG + Intergenic
980489341 4:133505538-133505560 AGTGGGATCTTCCAATCTGTGGG - Intergenic
980787486 4:137573222-137573244 AGTGAGAACTTCCAATCCGTGGG + Intergenic
980864779 4:138542207-138542229 AGTGGGATCTTCCGATCTATGGG - Intergenic
980885619 4:138759252-138759274 AAGGGTATCTTCTGATCCCTAGG + Intergenic
981186971 4:141815686-141815708 AATGGGATCTTCTGATCCGTGGG - Intergenic
981237481 4:142435772-142435794 AGTGGGAACTTCCGATCTATGGG - Intronic
981352753 4:143752041-143752063 AGTGGGATCTTTTGATCCGTGGG - Intergenic
982452873 4:155573172-155573194 AGTGGGATCTGCCAATCCGTGGG - Intergenic
982528152 4:156505599-156505621 AGTGGGATCTTCTAATCCATGGG - Intergenic
982663243 4:158230127-158230149 AGTGGGATCTTCCAATCTGTAGG + Intronic
983726862 4:170940255-170940277 AGTGGGATCTTCTGAACCGTGGG - Intergenic
983774970 4:171595106-171595128 AGGAGGATCTCCTGATCCTTAGG + Intergenic
983972339 4:173890263-173890285 AGTGGGATCTTTCGATCTGTAGG + Intergenic
984092036 4:175387090-175387112 AGTGGGATCTTCTGATCCACGGG - Intergenic
984215692 4:176910668-176910690 AGTGGGATCTTCTGGTCCACGGG - Intergenic
984334941 4:178378970-178378992 AGTGGAATCTTCCAATCTGTGGG - Intergenic
984915308 4:184718284-184718306 AGTGGGTTGTTCAGAACCGTAGG + Intronic
986140585 5:5026240-5026262 AGTAAGATCTTCTGATCCATGGG - Intergenic
986492362 5:8306329-8306351 CGTGGGATCTTTTGATCCATGGG - Intergenic
987399906 5:17464125-17464147 AATGGGATCTTCCGATCCATGGG + Intergenic
987453804 5:18119253-18119275 AGCGGGATCTTCCAATCTGTGGG - Intergenic
987457202 5:18162584-18162606 AGTGGAATCTTCCAATCCATGGG + Intergenic
987834770 5:23146560-23146582 AGCGGGATCTTCTGATCTGTGGG + Intergenic
988059436 5:26148562-26148584 AGTGGTATCTTCTGATCCGTGGG - Intergenic
988076643 5:26362881-26362903 AGTGGGATCTTCTGATCCATGGG + Intergenic
988186516 5:27871070-27871092 AGTGGGATCTTCTGATCTGTGGG - Intergenic
989091975 5:37743289-37743311 AGTGGGATCTTCTGATCCGTGGG - Intronic
989348290 5:40454047-40454069 AGTGGGATCTTCCAATCCATGGG + Intergenic
989676756 5:43981867-43981889 AGTGAGATCTTCCAATCCGTGGG + Intergenic
990015985 5:51063581-51063603 AGTGGGATTTTCCAATCCATGGG - Intergenic
990620182 5:57550550-57550572 AATGGGATCTTCTGATCTGTGGG + Intergenic
993020505 5:82585177-82585199 GAGGGGACCTTCTGATCCGTGGG + Intergenic
993117325 5:83734105-83734127 AGTAGGATCTTCTGATCTGTGGG + Intergenic
993587392 5:89747345-89747367 AGTTGGATCTTCTTATCTGTGGG + Intergenic
994344466 5:98668591-98668613 AGTGGGAACTTCCAATCCCTGGG - Intergenic
994551401 5:101239373-101239395 AAGGGGATCTCCTGATCCATGGG + Intergenic
994843255 5:104952232-104952254 AGTGGGATCTTCTGATCCACAGG + Intergenic
995002949 5:107157773-107157795 AGTAGGTTCTTCTAATCCATGGG - Intergenic
995080596 5:108047305-108047327 ACTGGGATCTTCTGATCTGTGGG - Intronic
995264263 5:110139382-110139404 AGTGGGATCTTCTGATCTGTGGG + Intergenic
995594284 5:113731346-113731368 GGTGGGATCTTCCAATCCGTGGG + Intergenic
995685421 5:114766724-114766746 AGTGGGATCTTCCAATTCATGGG + Intergenic
995694781 5:114866714-114866736 AAGGGGATCTCCTGATCCATAGG - Intergenic
996482315 5:123988822-123988844 AAGGGGATCTCCTGATCCGGAGG + Intergenic
996527308 5:124492511-124492533 AGTGGGATCTTCCAATCCGTGGG + Intergenic
996638985 5:125730126-125730148 AGTGGGATCTTCTGATCTGTGGG - Intergenic
996675632 5:126171930-126171952 AGTGGGAGCTTCCGATCTTTGGG - Intergenic
996691291 5:126342953-126342975 TGTGGGATCCTCTCAGCCGTTGG - Intergenic
996893768 5:128455792-128455814 AGTGGGATCCTCCGATTCGTGGG - Intronic
998277961 5:140776480-140776502 AGTGGAATCTTCCGATCTGTGGG + Intergenic
998788747 5:145743680-145743702 AGTGGGATCTTCCGACCCACGGG - Intronic
999938527 5:156515642-156515664 AAGGGTATCTTCTGATCCATGGG - Intronic
1001839772 5:174865102-174865124 AGTGGGATCTTCCGACCCGTGGG + Intergenic
1002967090 6:1977749-1977771 GAGGGGATCTCCTGATCCGTGGG - Intronic
1003248677 6:4405642-4405664 AGTGGGATCTTCCAATCCGTAGG - Intergenic
1003687163 6:8315465-8315487 AGTGGGATCTTCCAATCTGTGGG + Intergenic
1004027941 6:11837190-11837212 AGGGGAATCTCCTGATCTGTGGG - Intergenic
1004760026 6:18656395-18656417 AGTGGGATCTTCCAATCTGTGGG - Intergenic
1004984005 6:21059443-21059465 AGGGGGATCTACTGATCCATGGG + Intronic
1005121115 6:22390088-22390110 AGTGGGATCTTCCGATCCATGGG + Intergenic
1006742084 6:36316184-36316206 AGTGAGATCTTGTGACCCTTGGG - Exonic
1008082562 6:47209673-47209695 AAGGAGATCTTCTGATCCGAGGG - Intergenic
1008468324 6:51855058-51855080 AGTGGGATCTTCCGACCCATGGG + Intronic
1008741499 6:54614785-54614807 AGTGGGATCTTCTGATCCATCGG - Intergenic
1008773727 6:55009518-55009540 AGTGGGATCTTCCGATCCAAGGG + Intergenic
1008819047 6:55609055-55609077 AATGGGATCTTTCGATCCGTGGG - Intergenic
1008834464 6:55808611-55808633 CGTGGGATCTTCCAATCTGTGGG + Intronic
1009059981 6:58387245-58387267 AAGGGGATCTTCTGATCCACAGG - Intergenic
1009316785 6:62229642-62229664 AGTGGGATCTTCCAATTCGTGGG + Intronic
1009707180 6:67266630-67266652 AGGAGGATCTTCTGATCCATGGG + Intergenic
1009916851 6:70006296-70006318 AGTGGGATTTTCCCATCCATGGG + Intronic
1010283020 6:74041750-74041772 AGTGGGATCTTCCAATCCGTGGG + Intergenic
1010331218 6:74626317-74626339 AGTGGGATTTTCCAATCTGTGGG - Intergenic
1010411621 6:75568161-75568183 AGTGGGATCTTCTGATCCATGGG - Intergenic
1010483279 6:76379593-76379615 AGTGGGATCTTCCAGTCCATGGG + Intergenic
1010945550 6:81969911-81969933 AGTGGGATCTTCCGATCCGAAGG - Intergenic
1013920517 6:115396926-115396948 AAGGGGATCTCCTGATCTGTGGG + Intergenic
1014047179 6:116903565-116903587 AGTGGTAACTTCTGATGAGTAGG - Intronic
1014064642 6:117110769-117110791 AGTGGGATCTTCCAATCCTTGGG - Intergenic
1014225673 6:118843769-118843791 AGTCAGATATTCTGATCCGGCGG + Intronic
1014422242 6:121260644-121260666 AGTGGGATCTTCTGAACCATGGG - Intronic
1014477378 6:121890101-121890123 AGTGGGATCTTTTGAGCCCTGGG + Intergenic
1015945798 6:138499644-138499666 AGGAGGAACTTCTGATCTGTTGG - Intronic
1016379156 6:143455854-143455876 AGTAGGATTTTGTGATCTGTTGG + Intronic
1016790832 6:148065203-148065225 AAGGGGATCTCCTGATCCATGGG + Intergenic
1019113595 6:169738429-169738451 AGTGGAATCTTCTGATCTGTGGG + Intergenic
1019669663 7:2270664-2270686 AGTGGGATCTTTTGAGCCCTGGG - Intronic
1021186930 7:17575733-17575755 AAGGGGATCTTCTGATCCATGGG - Intergenic
1022634562 7:32119752-32119774 AGTGGGATCTTCTGATCCATGGG - Intronic
1023207115 7:37763274-37763296 AGTGGGATCTTCTGATCTGTGGG - Intronic
1024589925 7:50872485-50872507 AGGGGGATTTCCTGATCTGTGGG - Intergenic
1027875589 7:83763852-83763874 GGTGGGATTTTATGATCCATTGG - Intergenic
1027943979 7:84722648-84722670 AGTGGCATCTTCTCATCCATGGG - Intergenic
1028048839 7:86158142-86158164 AGTGGGGTCTTCCGACCTGTGGG - Intergenic
1028442453 7:90879960-90879982 AGTGGGATCTTCCGATTGGTGGG - Intronic
1028459104 7:91071527-91071549 AGTGGGATCTTCCGATCCGTGGG - Intronic
1028522936 7:91752500-91752522 AGTGGGATTCCCTGATCTGTGGG - Intronic
1030701643 7:112647222-112647244 AGTGGGATCTTCCAATCCGTGGG + Intergenic
1031254195 7:119427747-119427769 AAGGGGATCTCCTGATCCATAGG - Intergenic
1031804515 7:126292363-126292385 AGAGGGAACTTCCGATCCGTGGG - Intergenic
1032274803 7:130445123-130445145 AGTGGGACCTGCAGATCTGTGGG - Intergenic
1032776741 7:135121900-135121922 AGTGGGATCTTCCAATCTATAGG - Intronic
1032919860 7:136533788-136533810 AGTGGGATATTCTGATCCATGGG - Intergenic
1033879341 7:145862256-145862278 AGTGGGATCTTCCGATCCGTGGG - Intergenic
1035491623 7:159284533-159284555 AGTGGGATCTTCTGATTCATGGG - Intergenic
1035599618 8:889898-889920 AGTGGGATCTTCTGATCCGTGGG + Intergenic
1037421596 8:18708972-18708994 AAGGGGATCTCCTGATCCGCAGG - Intronic
1038073629 8:24046080-24046102 AGTGGGATCTTCTGATCCGTGGG - Intergenic
1038243403 8:25831280-25831302 AATGGGATCTTCTGATCCATGGG + Intergenic
1038253348 8:25926860-25926882 AGGGGGATAATCTGATCTGTTGG - Intronic
1039265077 8:35815597-35815619 AGTGGGATCTTCTGATCCATGGG - Intergenic
1039293910 8:36128043-36128065 AGTGGGATCTTCCCATCCATGGG + Intergenic
1039402168 8:37279247-37279269 AGTGGGATCTTCTGATCCATGGG - Intergenic
1039407292 8:37324321-37324343 AGTTGGCTCTTCTTATCCATGGG + Intergenic
1039658172 8:39433259-39433281 AGTGGGATTTTCCAATCCATGGG - Intergenic
1040401654 8:47056285-47056307 AGTAGGATGTTCTGTTCTGTAGG - Intergenic
1040614259 8:49018682-49018704 AGTTGGATCTTCTGATCCGTGGG + Intergenic
1040763030 8:50874020-50874042 AGTGGGATCTTCCAATCCATGGG - Intergenic
1041021429 8:53642632-53642654 CGTGGGATATTCTGATCCGTGGG + Intergenic
1041211912 8:55560073-55560095 AGTGGGATCTTTTAATCCGTGGG + Intergenic
1041742998 8:61176824-61176846 AGTGGGATCTTTCAATCTGTGGG - Intronic
1041890126 8:62859080-62859102 AAGGGGATCTCCTGATCCGCAGG + Intronic
1042759607 8:72256904-72256926 AGTGAGATCTTCTTATCTGTAGG - Intergenic
1043223900 8:77699823-77699845 AGTGGAAACTTCCGATCCCTAGG + Intergenic
1044038669 8:87337611-87337633 AGTGTGATCTTCCAATCTGTTGG + Intronic
1044135902 8:88584922-88584944 AGTGGGATATTCCGATCTGTGGG + Intergenic
1044356214 8:91225310-91225332 AGTGGGATCTTCTGATCTGTGGG + Intronic
1045705375 8:104916464-104916486 AGTGGGATCTTCCGATCCGTGGG + Intronic
1046330867 8:112713235-112713257 AGTGGGATCTTCTGATCTGTGGG - Intronic
1046702649 8:117418648-117418670 AGGGGGATCTTCTGATCCAAGGG - Intergenic
1048587783 8:135790974-135790996 AGTGGGATCTTCCAATCCGTGGG + Intergenic
1050618344 9:7426559-7426581 AGAGGGATCTTCTGATCCACGGG + Intergenic
1050630028 9:7549256-7549278 AGTGGGATCTTCTGATTCATGGG - Intergenic
1050660673 9:7879883-7879905 AGTGGGATCTTCCAATCCGTGGG - Intronic
1050873897 9:10612587-10612609 AGTGGGATCTTCTTTTCCGGAGG + Intronic
1052115761 9:24646751-24646773 AGTGGGATCTTCCAATCCATGGG + Intergenic
1052225354 9:26078265-26078287 AATGGGATCTTCCAATCCGTGGG + Intergenic
1052369168 9:27645173-27645195 AGTGGGATCTTTCAATCCGTGGG - Intergenic
1055818782 9:80237994-80238016 TGTGGGATCTTCTGATCCATGGG - Intergenic
1057241716 9:93417223-93417245 AGGGGGATCTCCTGATCCATGGG + Intergenic
1058374236 9:104304915-104304937 AGTGGGATCTTCTGATCCGTGGG - Intergenic
1059004273 9:110384173-110384195 AGGGGGATCTCCTGATCTGCAGG + Intronic
1059262760 9:112994139-112994161 AAGGGGATCTCCTGATCTGTGGG + Intergenic
1059596227 9:115723851-115723873 AGCGGGATCTTCCCATCCGTGGG - Intergenic
1059622408 9:116021551-116021573 AGTGGGACTTTCTGATTGGTGGG - Intergenic
1060321181 9:122562460-122562482 AGTGGGATCTTCTGATCTGTGGG + Intergenic
1060340057 9:122767580-122767602 AAGGGGATCTCCTGATCCATGGG - Intergenic
1062702591 9:137915296-137915318 TGTGGCATCTTCTGATCATTCGG + Intronic
1185846352 X:3441361-3441383 AGTGGGATCTTCCGATCCATGGG + Intergenic
1185952410 X:4451652-4451674 AATGGGATCTTCCAATCCGTAGG - Intergenic
1186430863 X:9503299-9503321 AGTGAGATCTTCCAATCCGTGGG - Intronic
1187818123 X:23255782-23255804 GAGGGGATCTTCTGATCCGCTGG - Intergenic
1188092086 X:25976767-25976789 AGTGGGATCTTCCAATCCGTGGG - Intergenic
1188669693 X:32868215-32868237 AGTGGGATCTCCTGATCTGCGGG - Intronic
1188884264 X:35531066-35531088 AGTGGGATCTTCTGATCCGTGGG - Intergenic
1190529532 X:51361297-51361319 AGTGGGATATTCCGATCCATGGG - Intergenic
1191065610 X:56343797-56343819 AATGGGATCTCCTGATCTGCAGG + Intergenic
1191081759 X:56519149-56519171 AGTGGGAAATAGTGATCCGTGGG + Intergenic
1191225267 X:58035591-58035613 AGTGGAATCTTCTGATCTGTGGG + Intergenic
1191701476 X:64047356-64047378 TGAGGGATCTCCTGATCCATGGG - Intergenic
1191775313 X:64807595-64807617 AGTGGAATCTTCCAATCTGTGGG - Intergenic
1192716377 X:73647175-73647197 AGTGGGATCTTCCAATACGTGGG - Intronic
1192951874 X:76026130-76026152 AGTGGGATCTTCTGATCTGTGGG - Intergenic
1192960590 X:76126757-76126779 AAGGGGATCTCCTGATCTGTGGG - Intergenic
1193039234 X:76987355-76987377 AGTGGGTTCTTATGATCCATGGG - Intergenic
1193048444 X:77077296-77077318 GGTGGGATCTTCCAATCCATGGG + Intergenic
1193091026 X:77494169-77494191 AATGGGATCTTCTGATCCATGGG - Intergenic
1193227197 X:78998217-78998239 AGTAGGATCTTTTGATCCATGGG - Intergenic
1193533692 X:82686885-82686907 AGGGGGATCTCCTGATCTCTGGG + Intergenic
1193595479 X:83439614-83439636 AGTGGGATCTCCTTATCTGTGGG + Intergenic
1193719586 X:84971792-84971814 AGTGGGATCTTCCGATCCATGGG + Intergenic
1193768602 X:85561558-85561580 AGTGGGATCTTCCGATCCATGGG + Intergenic
1193780853 X:85699315-85699337 AGTGGGATCATCCGGTCCATGGG + Intergenic
1194058269 X:89164113-89164135 AGTGGGATCTTCTAATCTGTGGG + Intergenic
1194183053 X:90737328-90737350 AGAGGGATCTCCTGTTCCATGGG - Intergenic
1194193435 X:90864930-90864952 ATTGGGATCTCCTGATTCATGGG - Intergenic
1194264076 X:91734001-91734023 AGGGGGATCTTCTGATCTGTGGG + Intergenic
1194286717 X:92020059-92020081 AGTGGAATCTTCTGGTTCATGGG - Intronic
1194489613 X:94530405-94530427 AGTGGGATCTCCTGATCCATGGG - Intergenic
1194523078 X:94942596-94942618 AGTGAGATCTTCTGATCCGTGGG - Intergenic
1195147113 X:102029035-102029057 AGTGAGATCTTCTGATCCATGGG - Intergenic
1195979426 X:110561550-110561572 AGTGGGATCTTCTGATCTGTGGG + Intergenic
1195983055 X:110600764-110600786 AGTGGGATCTTCGGTTCCGTGGG - Intergenic
1196229356 X:113203085-113203107 AGGGGGATCTTCTTATCTGTGGG + Intergenic
1196363787 X:114899523-114899545 AAGGGGATCTCCTGATCTGTGGG + Intronic
1196517338 X:116628903-116628925 AGTGGGAACTTCTGATTCGTGGG + Intergenic
1196555941 X:117084306-117084328 AGTGGGATCTTCTGAACTGTGGG + Intergenic
1196607426 X:117672118-117672140 AGTGGGATTTTCCCATCCATGGG + Intergenic
1197049629 X:122042797-122042819 AGTGGGATCTTCTGATCCATGGG + Intergenic
1197124208 X:122925084-122925106 AGTGGAATCTTCTGATCCATGGG + Intergenic
1197403991 X:126027845-126027867 AGTGGGATCTTCCAATCTGTGGG + Intergenic
1197607175 X:128597810-128597832 AGTGGGATCTTGCGATCTATGGG + Intergenic
1198492882 X:137161133-137161155 ATTGGGATTTTCTGATCCAGAGG + Intergenic
1198687003 X:139237756-139237778 AGGGGGATCTCCTGATCTGCAGG - Intergenic
1199564431 X:149199373-149199395 AGGGGGATCTCCTGATCTGTAGG + Intergenic
1199567448 X:149230345-149230367 AGTGGGATCTTCCGATCTGTGGG + Intergenic
1200529672 Y:4319283-4319305 AGAGGGATCTCCTGTTCCATGGG - Intergenic
1200540046 Y:4447317-4447339 ATTGGGATCTCCTGATTCATGGG - Intergenic
1200604262 Y:5244619-5244641 AGTGGAATCTTCTGGTTCATGGG - Intronic
1200818150 Y:7555011-7555033 AGTGGGATCTTCCGATCCATGGG - Intergenic
1201934045 Y:19386671-19386693 AGAGAGATCTTGTGATCTGTGGG + Intergenic
1202070364 Y:20985752-20985774 AGTAGGATCTTCTGATCCGTTGG + Intergenic
1202075339 Y:21031841-21031863 AGTGGGACCTTTTGATCCATGGG + Intergenic
1202092468 Y:21208542-21208564 GATGGGATCTTCTGATCTGTGGG - Intergenic