ID: 1035599619

View in Genome Browser
Species Human (GRCh38)
Location 8:889906-889928
Sequence CTTCTGATCCGTGGGTTGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035599614_1035599619 4 Left 1035599614 8:889879-889901 CCAGTGGCGTGAGTTTGCAAGTG No data
Right 1035599619 8:889906-889928 CTTCTGATCCGTGGGTTGCACGG No data
1035599612_1035599619 6 Left 1035599612 8:889877-889899 CCCCAGTGGCGTGAGTTTGCAAG No data
Right 1035599619 8:889906-889928 CTTCTGATCCGTGGGTTGCACGG No data
1035599610_1035599619 25 Left 1035599610 8:889858-889880 CCGGGGCTGGAACTGTAGGCCCC No data
Right 1035599619 8:889906-889928 CTTCTGATCCGTGGGTTGCACGG No data
1035599613_1035599619 5 Left 1035599613 8:889878-889900 CCCAGTGGCGTGAGTTTGCAAGT No data
Right 1035599619 8:889906-889928 CTTCTGATCCGTGGGTTGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035599619 Original CRISPR CTTCTGATCCGTGGGTTGCA CGG Intergenic
No off target data available for this crispr