ID: 1035599621

View in Genome Browser
Species Human (GRCh38)
Location 8:889914-889936
Sequence CCGTGGGTTGCACGGTTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035599613_1035599621 13 Left 1035599613 8:889878-889900 CCCAGTGGCGTGAGTTTGCAAGT No data
Right 1035599621 8:889914-889936 CCGTGGGTTGCACGGTTTTGTGG No data
1035599612_1035599621 14 Left 1035599612 8:889877-889899 CCCCAGTGGCGTGAGTTTGCAAG No data
Right 1035599621 8:889914-889936 CCGTGGGTTGCACGGTTTTGTGG No data
1035599614_1035599621 12 Left 1035599614 8:889879-889901 CCAGTGGCGTGAGTTTGCAAGTG No data
Right 1035599621 8:889914-889936 CCGTGGGTTGCACGGTTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035599621 Original CRISPR CCGTGGGTTGCACGGTTTTG TGG Intergenic
No off target data available for this crispr