ID: 1035599831

View in Genome Browser
Species Human (GRCh38)
Location 8:890974-890996
Sequence AGGACCTGGGTCAGTGCTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035599812_1035599831 25 Left 1035599812 8:890926-890948 CCACCCGGCTGTGCCCCTTACTG No data
Right 1035599831 8:890974-890996 AGGACCTGGGTCAGTGCTATTGG No data
1035599814_1035599831 22 Left 1035599814 8:890929-890951 CCCGGCTGTGCCCCTTACTGGCT No data
Right 1035599831 8:890974-890996 AGGACCTGGGTCAGTGCTATTGG No data
1035599816_1035599831 12 Left 1035599816 8:890939-890961 CCCCTTACTGGCTCCCCCTTGTC No data
Right 1035599831 8:890974-890996 AGGACCTGGGTCAGTGCTATTGG No data
1035599821_1035599831 -3 Left 1035599821 8:890954-890976 CCCTTGTCCTCACTGCCCCCAGG No data
Right 1035599831 8:890974-890996 AGGACCTGGGTCAGTGCTATTGG No data
1035599820_1035599831 -2 Left 1035599820 8:890953-890975 CCCCTTGTCCTCACTGCCCCCAG No data
Right 1035599831 8:890974-890996 AGGACCTGGGTCAGTGCTATTGG No data
1035599825_1035599831 -10 Left 1035599825 8:890961-890983 CCTCACTGCCCCCAGGACCTGGG No data
Right 1035599831 8:890974-890996 AGGACCTGGGTCAGTGCTATTGG No data
1035599809_1035599831 30 Left 1035599809 8:890921-890943 CCCGCCCACCCGGCTGTGCCCCT No data
Right 1035599831 8:890974-890996 AGGACCTGGGTCAGTGCTATTGG No data
1035599815_1035599831 21 Left 1035599815 8:890930-890952 CCGGCTGTGCCCCTTACTGGCTC No data
Right 1035599831 8:890974-890996 AGGACCTGGGTCAGTGCTATTGG No data
1035599823_1035599831 -4 Left 1035599823 8:890955-890977 CCTTGTCCTCACTGCCCCCAGGA No data
Right 1035599831 8:890974-890996 AGGACCTGGGTCAGTGCTATTGG No data
1035599818_1035599831 10 Left 1035599818 8:890941-890963 CCTTACTGGCTCCCCCTTGTCCT No data
Right 1035599831 8:890974-890996 AGGACCTGGGTCAGTGCTATTGG No data
1035599810_1035599831 29 Left 1035599810 8:890922-890944 CCGCCCACCCGGCTGTGCCCCTT No data
Right 1035599831 8:890974-890996 AGGACCTGGGTCAGTGCTATTGG No data
1035599817_1035599831 11 Left 1035599817 8:890940-890962 CCCTTACTGGCTCCCCCTTGTCC No data
Right 1035599831 8:890974-890996 AGGACCTGGGTCAGTGCTATTGG No data
1035599819_1035599831 -1 Left 1035599819 8:890952-890974 CCCCCTTGTCCTCACTGCCCCCA No data
Right 1035599831 8:890974-890996 AGGACCTGGGTCAGTGCTATTGG No data
1035599811_1035599831 26 Left 1035599811 8:890925-890947 CCCACCCGGCTGTGCCCCTTACT No data
Right 1035599831 8:890974-890996 AGGACCTGGGTCAGTGCTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035599831 Original CRISPR AGGACCTGGGTCAGTGCTAT TGG Intergenic
No off target data available for this crispr