ID: 1035599887

View in Genome Browser
Species Human (GRCh38)
Location 8:891167-891189
Sequence CCTCAATCACACCTGTGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035599887_1035599896 23 Left 1035599887 8:891167-891189 CCAGGCCACAGGTGTGATTGAGG No data
Right 1035599896 8:891213-891235 CAAGGACCCGTGTGGCGACCAGG No data
1035599887_1035599894 5 Left 1035599887 8:891167-891189 CCAGGCCACAGGTGTGATTGAGG No data
Right 1035599894 8:891195-891217 GCTGAAGGTGAAAGGCGACAAGG No data
1035599887_1035599892 -10 Left 1035599887 8:891167-891189 CCAGGCCACAGGTGTGATTGAGG No data
Right 1035599892 8:891180-891202 GTGATTGAGGGCATGGCTGAAGG No data
1035599887_1035599893 -3 Left 1035599887 8:891167-891189 CCAGGCCACAGGTGTGATTGAGG No data
Right 1035599893 8:891187-891209 AGGGCATGGCTGAAGGTGAAAGG No data
1035599887_1035599898 29 Left 1035599887 8:891167-891189 CCAGGCCACAGGTGTGATTGAGG No data
Right 1035599898 8:891219-891241 CCCGTGTGGCGACCAGGACCAGG No data
1035599887_1035599895 15 Left 1035599887 8:891167-891189 CCAGGCCACAGGTGTGATTGAGG No data
Right 1035599895 8:891205-891227 AAAGGCGACAAGGACCCGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035599887 Original CRISPR CCTCAATCACACCTGTGGCC TGG (reversed) Intergenic
No off target data available for this crispr