ID: 1035604486

View in Genome Browser
Species Human (GRCh38)
Location 8:920698-920720
Sequence AGATTGCCCAAGCACGATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035604486_1035604489 0 Left 1035604486 8:920698-920720 CCATGATCGTGCTTGGGCAATCT No data
Right 1035604489 8:920721-920743 GCCCAGCCTGGGCGACAGAGCGG No data
1035604486_1035604491 1 Left 1035604486 8:920698-920720 CCATGATCGTGCTTGGGCAATCT No data
Right 1035604491 8:920722-920744 CCCAGCCTGGGCGACAGAGCGGG No data
1035604486_1035604495 19 Left 1035604486 8:920698-920720 CCATGATCGTGCTTGGGCAATCT No data
Right 1035604495 8:920740-920762 GCGGGACTGCACACCAGCCTGGG No data
1035604486_1035604494 18 Left 1035604486 8:920698-920720 CCATGATCGTGCTTGGGCAATCT No data
Right 1035604494 8:920739-920761 AGCGGGACTGCACACCAGCCTGG No data
1035604486_1035604496 30 Left 1035604486 8:920698-920720 CCATGATCGTGCTTGGGCAATCT No data
Right 1035604496 8:920751-920773 CACCAGCCTGGGTGACAGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035604486 Original CRISPR AGATTGCCCAAGCACGATCA TGG (reversed) Intergenic
No off target data available for this crispr