ID: 1035605474

View in Genome Browser
Species Human (GRCh38)
Location 8:927388-927410
Sequence AGGTAGACCCAAGAGCCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035605474_1035605480 9 Left 1035605474 8:927388-927410 CCCCAAGGCTCTTGGGTCTACCT No data
Right 1035605480 8:927420-927442 CGGCACACACCAAAGGTCTCAGG No data
1035605474_1035605482 13 Left 1035605474 8:927388-927410 CCCCAAGGCTCTTGGGTCTACCT No data
Right 1035605482 8:927424-927446 ACACACCAAAGGTCTCAGGGTGG No data
1035605474_1035605481 10 Left 1035605474 8:927388-927410 CCCCAAGGCTCTTGGGTCTACCT No data
Right 1035605481 8:927421-927443 GGCACACACCAAAGGTCTCAGGG No data
1035605474_1035605479 2 Left 1035605474 8:927388-927410 CCCCAAGGCTCTTGGGTCTACCT No data
Right 1035605479 8:927413-927435 GCATACGCGGCACACACCAAAGG No data
1035605474_1035605484 29 Left 1035605474 8:927388-927410 CCCCAAGGCTCTTGGGTCTACCT No data
Right 1035605484 8:927440-927462 AGGGTGGAATTGTTCACGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035605474 Original CRISPR AGGTAGACCCAAGAGCCTTG GGG (reversed) Intergenic