ID: 1035605478

View in Genome Browser
Species Human (GRCh38)
Location 8:927408-927430
Sequence GGTGTGTGCCGCGTATGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035605478_1035605485 26 Left 1035605478 8:927408-927430 CCTGAGCATACGCGGCACACACC No data
Right 1035605485 8:927457-927479 GTCAGGAATGTGCTTTGAGCAGG No data
1035605478_1035605482 -7 Left 1035605478 8:927408-927430 CCTGAGCATACGCGGCACACACC No data
Right 1035605482 8:927424-927446 ACACACCAAAGGTCTCAGGGTGG No data
1035605478_1035605484 9 Left 1035605478 8:927408-927430 CCTGAGCATACGCGGCACACACC No data
Right 1035605484 8:927440-927462 AGGGTGGAATTGTTCACGTCAGG No data
1035605478_1035605486 29 Left 1035605478 8:927408-927430 CCTGAGCATACGCGGCACACACC No data
Right 1035605486 8:927460-927482 AGGAATGTGCTTTGAGCAGGTGG No data
1035605478_1035605481 -10 Left 1035605478 8:927408-927430 CCTGAGCATACGCGGCACACACC No data
Right 1035605481 8:927421-927443 GGCACACACCAAAGGTCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035605478 Original CRISPR GGTGTGTGCCGCGTATGCTC AGG (reversed) Intergenic