ID: 1035605484

View in Genome Browser
Species Human (GRCh38)
Location 8:927440-927462
Sequence AGGGTGGAATTGTTCACGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035605476_1035605484 27 Left 1035605476 8:927390-927412 CCAAGGCTCTTGGGTCTACCTGA No data
Right 1035605484 8:927440-927462 AGGGTGGAATTGTTCACGTCAGG No data
1035605478_1035605484 9 Left 1035605478 8:927408-927430 CCTGAGCATACGCGGCACACACC No data
Right 1035605484 8:927440-927462 AGGGTGGAATTGTTCACGTCAGG No data
1035605474_1035605484 29 Left 1035605474 8:927388-927410 CCCCAAGGCTCTTGGGTCTACCT No data
Right 1035605484 8:927440-927462 AGGGTGGAATTGTTCACGTCAGG No data
1035605475_1035605484 28 Left 1035605475 8:927389-927411 CCCAAGGCTCTTGGGTCTACCTG No data
Right 1035605484 8:927440-927462 AGGGTGGAATTGTTCACGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035605484 Original CRISPR AGGGTGGAATTGTTCACGTC AGG Intergenic