ID: 1035608156

View in Genome Browser
Species Human (GRCh38)
Location 8:942896-942918
Sequence GCCCGTGTGGCTCTCCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035608156_1035608161 8 Left 1035608156 8:942896-942918 CCTCCCAGGAGAGCCACACGGGC No data
Right 1035608161 8:942927-942949 CTCTCCAGTGATGCGTTGCAAGG No data
1035608156_1035608162 9 Left 1035608156 8:942896-942918 CCTCCCAGGAGAGCCACACGGGC No data
Right 1035608162 8:942928-942950 TCTCCAGTGATGCGTTGCAAGGG No data
1035608156_1035608164 16 Left 1035608156 8:942896-942918 CCTCCCAGGAGAGCCACACGGGC No data
Right 1035608164 8:942935-942957 TGATGCGTTGCAAGGGTGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035608156 Original CRISPR GCCCGTGTGGCTCTCCTGGG AGG (reversed) Intergenic
No off target data available for this crispr