ID: 1035608161

View in Genome Browser
Species Human (GRCh38)
Location 8:942927-942949
Sequence CTCTCCAGTGATGCGTTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035608159_1035608161 -5 Left 1035608159 8:942909-942931 CCACACGGGCATGTTTGCCTCTC No data
Right 1035608161 8:942927-942949 CTCTCCAGTGATGCGTTGCAAGG No data
1035608151_1035608161 18 Left 1035608151 8:942886-942908 CCCAAAACTCCCTCCCAGGAGAG No data
Right 1035608161 8:942927-942949 CTCTCCAGTGATGCGTTGCAAGG No data
1035608157_1035608161 5 Left 1035608157 8:942899-942921 CCCAGGAGAGCCACACGGGCATG No data
Right 1035608161 8:942927-942949 CTCTCCAGTGATGCGTTGCAAGG No data
1035608156_1035608161 8 Left 1035608156 8:942896-942918 CCTCCCAGGAGAGCCACACGGGC No data
Right 1035608161 8:942927-942949 CTCTCCAGTGATGCGTTGCAAGG No data
1035608154_1035608161 9 Left 1035608154 8:942895-942917 CCCTCCCAGGAGAGCCACACGGG No data
Right 1035608161 8:942927-942949 CTCTCCAGTGATGCGTTGCAAGG No data
1035608152_1035608161 17 Left 1035608152 8:942887-942909 CCAAAACTCCCTCCCAGGAGAGC No data
Right 1035608161 8:942927-942949 CTCTCCAGTGATGCGTTGCAAGG No data
1035608158_1035608161 4 Left 1035608158 8:942900-942922 CCAGGAGAGCCACACGGGCATGT No data
Right 1035608161 8:942927-942949 CTCTCCAGTGATGCGTTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035608161 Original CRISPR CTCTCCAGTGATGCGTTGCA AGG Intergenic
No off target data available for this crispr