ID: 1035609464

View in Genome Browser
Species Human (GRCh38)
Location 8:950289-950311
Sequence TGATTGTGATACAATTTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035609463_1035609464 -5 Left 1035609463 8:950271-950293 CCATTTTGCTTTATTTGATGATT No data
Right 1035609464 8:950289-950311 TGATTGTGATACAATTTGACAGG No data
1035609460_1035609464 24 Left 1035609460 8:950242-950264 CCAAAAATCATGAGGAAATACAG No data
Right 1035609464 8:950289-950311 TGATTGTGATACAATTTGACAGG No data
1035609462_1035609464 -4 Left 1035609462 8:950270-950292 CCCATTTTGCTTTATTTGATGAT No data
Right 1035609464 8:950289-950311 TGATTGTGATACAATTTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035609464 Original CRISPR TGATTGTGATACAATTTGAC AGG Intergenic
No off target data available for this crispr