ID: 1035611644

View in Genome Browser
Species Human (GRCh38)
Location 8:969501-969523
Sequence GAACCAACTGTTAAGTTTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035611642_1035611644 11 Left 1035611642 8:969467-969489 CCAGTGTGCTGGAGCAGCTCGTA No data
Right 1035611644 8:969501-969523 GAACCAACTGTTAAGTTTTTAGG No data
1035611640_1035611644 20 Left 1035611640 8:969458-969480 CCAGCAAACCCAGTGTGCTGGAG No data
Right 1035611644 8:969501-969523 GAACCAACTGTTAAGTTTTTAGG No data
1035611639_1035611644 21 Left 1035611639 8:969457-969479 CCCAGCAAACCCAGTGTGCTGGA No data
Right 1035611644 8:969501-969523 GAACCAACTGTTAAGTTTTTAGG No data
1035611641_1035611644 12 Left 1035611641 8:969466-969488 CCCAGTGTGCTGGAGCAGCTCGT No data
Right 1035611644 8:969501-969523 GAACCAACTGTTAAGTTTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035611644 Original CRISPR GAACCAACTGTTAAGTTTTT AGG Intergenic
No off target data available for this crispr