ID: 1035613649

View in Genome Browser
Species Human (GRCh38)
Location 8:986733-986755
Sequence CACTGAAACCTGCTTCTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035613647_1035613649 10 Left 1035613647 8:986700-986722 CCTAGGCTGGAGTGCAATGATGC 0: 615
1: 15989
2: 84015
3: 173382
4: 214859
Right 1035613649 8:986733-986755 CACTGAAACCTGCTTCTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035613649 Original CRISPR CACTGAAACCTGCTTCTCCC AGG Intergenic
No off target data available for this crispr