ID: 1035613962

View in Genome Browser
Species Human (GRCh38)
Location 8:988800-988822
Sequence CAGAAAAAGCAGGATTGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035613962_1035613966 2 Left 1035613962 8:988800-988822 CCTGACCAATCCTGCTTTTTCTG No data
Right 1035613966 8:988825-988847 TCATTTCCAAGCTCCACTGGTGG No data
1035613962_1035613965 -1 Left 1035613962 8:988800-988822 CCTGACCAATCCTGCTTTTTCTG No data
Right 1035613965 8:988822-988844 GCATCATTTCCAAGCTCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035613962 Original CRISPR CAGAAAAAGCAGGATTGGTC AGG (reversed) Intergenic
No off target data available for this crispr