ID: 1035615454

View in Genome Browser
Species Human (GRCh38)
Location 8:996888-996910
Sequence CAGTGTGACTTGTGGGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035615454_1035615460 25 Left 1035615454 8:996888-996910 CCACCTTCCCACAAGTCACACTG No data
Right 1035615460 8:996936-996958 TTTGGAACCCTTCATAGACCAGG No data
1035615454_1035615459 7 Left 1035615454 8:996888-996910 CCACCTTCCCACAAGTCACACTG No data
Right 1035615459 8:996918-996940 CCATTTTTAGAATTTCGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035615454 Original CRISPR CAGTGTGACTTGTGGGAAGG TGG (reversed) Intergenic
No off target data available for this crispr