ID: 1035616839

View in Genome Browser
Species Human (GRCh38)
Location 8:1008605-1008627
Sequence ACATTGGCTTCCACTGACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035616839_1035616843 14 Left 1035616839 8:1008605-1008627 CCTTTGTCAGTGGAAGCCAATGT No data
Right 1035616843 8:1008642-1008664 TTACTGTGCCGTAATTAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035616839 Original CRISPR ACATTGGCTTCCACTGACAA AGG (reversed) Intergenic
No off target data available for this crispr