ID: 1035617297

View in Genome Browser
Species Human (GRCh38)
Location 8:1011811-1011833
Sequence CAGTCTGCACAGTGGGCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035617292_1035617297 -6 Left 1035617292 8:1011794-1011816 CCTGGAATGAGAGTCCTCAGTCT No data
Right 1035617297 8:1011811-1011833 CAGTCTGCACAGTGGGCCCTGGG No data
1035617287_1035617297 28 Left 1035617287 8:1011760-1011782 CCTGGAATGAGGGGTCTCAGTCT No data
Right 1035617297 8:1011811-1011833 CAGTCTGCACAGTGGGCCCTGGG No data
1035617286_1035617297 29 Left 1035617286 8:1011759-1011781 CCCTGGAATGAGGGGTCTCAGTC No data
Right 1035617297 8:1011811-1011833 CAGTCTGCACAGTGGGCCCTGGG No data
1035617291_1035617297 -5 Left 1035617291 8:1011793-1011815 CCCTGGAATGAGAGTCCTCAGTC No data
Right 1035617297 8:1011811-1011833 CAGTCTGCACAGTGGGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035617297 Original CRISPR CAGTCTGCACAGTGGGCCCT GGG Intergenic
No off target data available for this crispr