ID: 1035619521

View in Genome Browser
Species Human (GRCh38)
Location 8:1027332-1027354
Sequence CTGGTACCACACCTGGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035619521_1035619525 -4 Left 1035619521 8:1027332-1027354 CCATTCTCCAGGTGTGGTACCAG No data
Right 1035619525 8:1027351-1027373 CCAGGTGCCCGTTATTCTCCAGG No data
1035619521_1035619526 -1 Left 1035619521 8:1027332-1027354 CCATTCTCCAGGTGTGGTACCAG No data
Right 1035619526 8:1027354-1027376 GGTGCCCGTTATTCTCCAGGTGG No data
1035619521_1035619528 1 Left 1035619521 8:1027332-1027354 CCATTCTCCAGGTGTGGTACCAG No data
Right 1035619528 8:1027356-1027378 TGCCCGTTATTCTCCAGGTGGGG No data
1035619521_1035619527 0 Left 1035619521 8:1027332-1027354 CCATTCTCCAGGTGTGGTACCAG No data
Right 1035619527 8:1027355-1027377 GTGCCCGTTATTCTCCAGGTGGG No data
1035619521_1035619535 30 Left 1035619521 8:1027332-1027354 CCATTCTCCAGGTGTGGTACCAG No data
Right 1035619535 8:1027385-1027407 GTGCCCGTTATTCTCCAGGTGGG No data
1035619521_1035619534 29 Left 1035619521 8:1027332-1027354 CCATTCTCCAGGTGTGGTACCAG No data
Right 1035619534 8:1027384-1027406 GGTGCCCGTTATTCTCCAGGTGG No data
1035619521_1035619533 26 Left 1035619521 8:1027332-1027354 CCATTCTCCAGGTGTGGTACCAG No data
Right 1035619533 8:1027381-1027403 CTTGGTGCCCGTTATTCTCCAGG No data
1035619521_1035619531 8 Left 1035619521 8:1027332-1027354 CCATTCTCCAGGTGTGGTACCAG No data
Right 1035619531 8:1027363-1027385 TATTCTCCAGGTGGGGTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035619521 Original CRISPR CTGGTACCACACCTGGAGAA TGG (reversed) Intergenic
No off target data available for this crispr