ID: 1035619955

View in Genome Browser
Species Human (GRCh38)
Location 8:1029199-1029221
Sequence CGGTTCCAGTGCAGGCTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035619955_1035619962 28 Left 1035619955 8:1029199-1029221 CCACAGAGCCTGCACTGGAACCG No data
Right 1035619962 8:1029250-1029272 GTCAACTGAAGCCGTAATTCTGG No data
1035619955_1035619960 3 Left 1035619955 8:1029199-1029221 CCACAGAGCCTGCACTGGAACCG No data
Right 1035619960 8:1029225-1029247 GGGAAAGATTCTTCCAGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035619955 Original CRISPR CGGTTCCAGTGCAGGCTCTG TGG (reversed) Intergenic
No off target data available for this crispr