ID: 1035625780

View in Genome Browser
Species Human (GRCh38)
Location 8:1069363-1069385
Sequence GGTCTCACTGGAGGACGGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035625767_1035625780 24 Left 1035625767 8:1069316-1069338 CCGGGTCGGACAGACCTGCGGCC No data
Right 1035625780 8:1069363-1069385 GGTCTCACTGGAGGACGGGCCGG No data
1035625773_1035625780 2 Left 1035625773 8:1069338-1069360 CCGTGGACAGGTCGCGAGGACAC No data
Right 1035625780 8:1069363-1069385 GGTCTCACTGGAGGACGGGCCGG No data
1035625770_1035625780 10 Left 1035625770 8:1069330-1069352 CCTGCGGCCCGTGGACAGGTCGC No data
Right 1035625780 8:1069363-1069385 GGTCTCACTGGAGGACGGGCCGG No data
1035625772_1035625780 3 Left 1035625772 8:1069337-1069359 CCCGTGGACAGGTCGCGAGGACA No data
Right 1035625780 8:1069363-1069385 GGTCTCACTGGAGGACGGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035625780 Original CRISPR GGTCTCACTGGAGGACGGGC CGG Intergenic
No off target data available for this crispr